Font Size: a A A

Association Of IL-1αC-889T Polymorphism With Coronary Artery Disease In Chinese

Posted on:2006-11-29Degree:MasterType:Thesis
Country:ChinaCandidate:C L HuangFull Text:PDF
GTID:2144360152993317Subject:Internal Medicine
Abstract/Summary:PDF Full Text Request
BackgroundCoronary artery disease (CAD) is associated intensely with the coagulation system. The disorder of blood coagulation are often found in CAD patients. Coagulation factors and antifibrinolytic mass are important in atherosclerosis. The rupture of atheromatous plaque and thrombosis is the major cause of acute myocardial infarction and unstable angina.Interleukin— 1 (IL-1) was echylosised by monocyte and macrophage, which including two sub molecule:IL-laand IL-1β.The express of mRNA of IL-laand IL-1β Receptor were reinforce after excited by the infection. Dissolubility IL-1 receptor of cell surface were ascensus, which were promote macrophage change to natural killer cell. The cytotoxicity of nature killer cell could enhance because of it. The IL-lawas a cytokine of hymenoration. It could regulate bureau paracrine secretion and autocrine. IL-1 also was intense inductor of GM-CSF and hepar acute stage protein. It's function include aggregation neutrophile cell to vessel wall,excition endothelial cell coagulation factor activity, enhancement white cell conjugation. However ,IL-1 was not directly pathopoiesised.It could derivate theexternalization of cytokine ,which could lead to severe disfunction of hemorrheology and metabolism.The destionation of research is To observe the frequencies of the polymorphism of IL-laC-889T in Chinese and the relationship between the polymorphism of IL-1αC-889T and coronary artery disease(CAD).Meterial and Methods1. Subjects282Han ethnic persons without blood relationship were recruited to the study. All of the person were performed selected coronary angiography and from the Cardiovascular Department of the Second Affiliated Hospital, Medical College of Zhejiang University. Among them, 126 CAD patients at least 50% obstruction of one major coronary vessel. The CAD group is divided into anginasubgroup (n=82) , old myocardial infarctionsubgroup(n=28) and acute myocardial infarction (n=16)using criteria defined by the World Health Organisation(WHO);156control subjects were from patients with normal angiography.2. Methods2.1. Collection of clinical features: All subjects were enquired in detail for history of hypertention, diabets, hyperlipemia, smoking. The stature, weight and major biochemical data were also determinated.2.2. Isolation of DNA. Cells were collected from EDTA anticoagulated blood and stored at -72℃, pending extraction by the salting out method.2.3. PCR amplification:Genotyping for the IL-1α-889 polymorphism was conducted essentially according to previous studies , PCR amplification of the relevant portion of the IL-1α promoter region was performed using the primers 5'GGGGGCTTCACTATGTTGCCCACACTGGACTAA (upstream) and 5'GAAGGCATGGATTTTTACATATGACCTTCCATG (downstream). Each of the 40 amplification cycles consisted of 1 min at 94 8C, 1 min at 58 8C, and 1 min at 728C. The final elongation step was 10 min at 72 8C.2.4 . Restriction digestion : For restriction digestion with Ncol, 7.5 ml werewithdrawn from the amplification mixture and incubated with 5 U of enzyme in thepresence in a final volume of 15 ml, at 37 °C, for 2 h. The polymorphism wasvisualized by separating the DNA contained in 7.5 ml of the Ncol digest, in a 2%agarose gel with ethidium bromide.2.5. Determination of CRP:80 patients of CAD and control was selected atrandom.The level serum of CRP was determined by active immunity backscatterradiation turbidity method.3. Statistical analysis: Using the SPSS 10.0 for windows statistical package. Countdata were performed by Student's t-test and measure data were performed bychi-squared test. Genotype and allele frequencies between groups were analysed bythe chi-squared test. Statistical significance was taken as p<0.05.Results1 . The frequencies of polymorphism of IL- laC-889T in the subjects :The frequencies of genotype in Chinese population was CC78.7%,CT 20.6%,TT 0.7%,The genotype distribution was in accordance with Hardy-Weinberg equilibrium.2 . The relationship between polymorphism of IL-laC-889T and CAD:The distribution...
Keywords/Search Tags:coronary artery disease, interleukin, gene, polymorphism, restriction fragment length, C-reactive protein
PDF Full Text Request
Related items