| At present Diazepam has been clinically proved to be effective on inducing uterine ripening, when administered intravenously during the first phase in labor. However there is a lack of the mechanism of uterine ripening caused by Diazepam. During the cervical ripening and dilation at term pregnancy, marked changes in collagen contents are observed. Cervical collagenase was reported to play an important role during the cervical ripening and dilation. Matrix Metallo-proteinase ( MMPs ) are a family of zinc-dependent endopeptidases that degrade extra cellular -matrix proteins including collagen. Our aim was to explore the mechanism of uterine ripening caused by Diazepam so as to provide enough fundamental proofs for clinical use of DiazepamMaterials and Methods1 Human Uterine Cervical Fibroblasts (HUCF) cell cultureHUCF were isolated from uterine of pregnant women and maintained in a culture DMEM containing 10% ( V/V)FCS. After the confluence, the serum free cultures were used for all the experiments. Diazepam dissolved in ethanol was added to the medium at the indicated concentrations in each experiment. The final concentration of ethanol was 0.1% ( V/V) in all culture, and the same amount of vehicle was added to the controls cultures. Harvested culture mediums were centrifuged at 1000g/min to remove cell debris and stored at - 20C. collect the HUCF and store in -70C.2 Assay for MMP-9The concentration of human MMP9( total) in the culture medium was meas-ured by ELISAReverse Transcription-Polymerase Chain Reaction ( RT-PCR) Total RNA extracted from HUCF was used to generate the MMP9 cDNAs. RNA was reverse transcribed to produce cDNA using reverse transcriptase( pro-mega, Madison, WI) and oligo dT as a primer. The cDNA for MMP( were amplified using 10% of the RT reaction in 100 containing 50 Taq polymerase ( per-kin-Elmer Fostercity, CA)with 0.2 mmol/LdNTPs and 1.5mmol/l MgCl2. Primers used for RT-PCR analysis of expression of transcripts for MMP-9 were up-stream5CGGAGCACGGAGACGGGTAT3; downstream5' AGGGCGAGGACCAT-AGAGG3 . predicted product size 824bp.ResultsAccording to our essay human uterine cervical fibroblasts in culture are capable of producing MMP9 , furthermore the production of MMP9 and the expression of MMP9mRNA is significantly enhanced by the addition of Diazepam.DiscussionCervical softening during pregnancy is very important for delivery. The cervix is composed of connective tissue and its mainly content is collagen. Cervical softening during pregnancy is likely to involve breakdown of collagens, which, in turn requires the presence of specific collagenases.Matrix metalloproteinases(MMPs) are a family of zinc-dependent endopep-tidases that degrade extracellular matrix proteins including collagen. They are secreted as zymogens (pro-MMPs)that are activated by a variety of proteinases or by reaction with organic mercurial. They are inhabited by specific tissue inhibitors of metalloproteinases(TIMPs). The Regulation of MMP activity is important in tissue remolding, inflammation, tumor, growth and metastasis.The production of MMP9 by HUCF has close relationship with cervical ripening , Winkler found that the concentration of MMP9 in the low uterine segment was related with the degree of cervix ripening by measuring their concentration ofdifferent stage. In the research of Frank, MMPs played an important role in the pregnancy development and maturation of cervix. We found that the concentrations of MMP9 with uterine concentrations were apparently higher than without. The concentration of MMP9 rise accompanied with the degree of the cervix ripening. And thus we can draw a conclusion that MMP9 degrade special substrate and lead to the resolve of collagen , the maturation and ripening of the cervix. So we thought that MMP9 was a middle link in the cervix part changes, promoted the degradation of collagen and maturation ripening of the cervix.ConclusionIn a word human uterine cervical fibroblasts in culture are capable of producing MMP9, furthermore the produc... |
PDF Full Text Request