| DCC (deleted in colorectal carcinoma) is a tumor suppressor gene which is located on the 18 q21.3. Its expressive production is phusphoprotein of 190KD, and it participates the interaction among cells or between cells and intercellular substanceAs the most vital vessel endothelial factor, VEGF( vascular endothelial growth factor) can induce the hyperplasia of vessels, and it plays an important rule in tumor growth and transfer. Often it has higher level of _expression in many cancer tissues and cells.P53 is a nuclear phosphoprotein with 393 amino acid (53 KD). The substances that the gene P53 produced will affect the life cycle of cells and apoptosts. It is known that the tumor suppressor gene P53 is the most active and frequent mutation gene in human cancer.To study the genes that are related to human cancer, many researches have proposed various hypothetical assumptions. Among them, it is commonly accepted that at least two or more cancer genes that have distinct functions interact each other in terms of their locations over time. As a result, these interactions may stimulate the cell mutation and cause cancer in human body.The ultimate byproducts of mutation gene DCC are various during tumor formation. One of them is the loss of heterozygosity (LOH). LOH reflects the dysfunction of tumor suppressor genes or their equivalent genes, and it has certain relations to the cancer reproduction or tumor transfer.Much research has been focused on the revealing the relationship between VEGF and P53. It has been recommended that there may be a higher correlation between both genes. Nevertheless, to date, it has not been reported yet that whether or not there are further changes in the _expression of VEGF and P53 in cancer tissues. In additional is well known that there is an extremely clear _expression of gene P53 and DCC in cancers within the digestive canal of human body. Therefore, our research will be focused on the exploration of the relationships among gene VEGF, P53, and DCC, and their direct effects on the tumor exacerbation in order to provide a microbiological explanation and interpretation to the occurrence of cancer. Meanwhile, related medical treatments and prevention will be discussed as well.MATERIALS AND METHODSImmunohistochemistry:1 . The source and selection of specimenThe paraffin sections were made of specimen from surgeries in colorectal patients in The Red Cross Hospital of Hangzhou from 1999 to 2002.. The main types of tissues are adenocarcinomas, mucinous, adenocarciomas, and signet-ring cell carcinomas, etc.2 Immunohistochemistry:The paraffin sections were diagnosed with dyed HE. Applying the two-step method to detect the expression of P53, VEGF, and DCC in colotectal. The antibody is P53 monocolonala antibody, VEGF murine anti human monocolonal antibody (purchased from Zhongshan Biotechnology Incorporate, Beijing) and DCC rabbit anti human polyclonal antibody (purchased from boshide biotechnology Incorporate,Wuhan). These two antibodies use a regular two-step immunohistochemistry test agent.3 Identification of outcomes:The protein P53 is located in nucleus of a cell, and it is evenly distributed in carcinomas. The dyed VEGF is in plasmalemma and plasma of a cell. The positive cells are diffused in carcinomas, and the protein DCC can also be found in the plasma of a cell. These positive proteins are in brown yellow color of tiny particles.Polymerase chain reaction 1. The source of specimenThe fresh resection samples came from the Red Cross Hospital of Hangzhou, stored in - 20 degree. The selected tissue includes the tissue of carcinomatpous, normal mucosa, the tissue between normal and carcinomatpous, as well as carcinomatpous lymphocyte.2 PCR expansion:It has been reported in literatures that PCR can be expanded at VNTR of the DCC gene based on the corresponding known sequence. The sequence of sense is 5 -GATGACATTTTCCCTCTAG-3 and sequence of antisense is 5' - GTGGTTATTGCCTTGAAAAG - 3. The predicted increment length of the object... |
PDF Full Text Request