SCAR Markers Linked To Thickness Gene Of Shuck In Walnut

Walnut was one of the main wood oil species,which was the head of four dried fruit. Although breeding technique had achieved a significant breakthrough,its quality was a restrictive factor for the industry of walnut.The healthy development of walnut industry was decided by the cultivation of excellent varieties.While the thickness was a dominant index causing the large price difference,because it could affect the rate of kernel and the difficulty to crack.Therefore,the thickness and inner wall were regarded as the key index to study.The difference of polymorphic diversity between two DNA pools can be identified quickly by using RAPD,which make walnut breeding transfer from selection by phenotypes to selection by genotypes,and accelerating the progress of study to quantitative trait in molecular level.In this paper,the thin walnut population and thick population in natural were selected as materials.RAPD marker T16₁₂₂₄ was generated using a PCR-based RAPD technique by bulk segregant analysis(BSA),which was probablely related to the precious characteristic for thickness of walnut.Sequence-characterized amplified region (SCAR) marker was developed from T16₁₂₂₄ sequences,using 22-mer oligonucleotide primers designed from the RAPD primer.Nucleus deposition method was used to extraction genomic of DNA from walnuts preserved for two years,one year,four months and ten days.Their concentration and pureness were measured.The results showed that leaf of walnut could disintegrate if preserved for a long time,and the extraction of DNA was affected.While the samples preserved one year can be compared with those preserved ten days,both which had a good results.Essential factors affecting the result of Rhododendron RAPD-PCR were studied with orthogonal design.And the optimal RAPD-PCR were built as follow:DNA 20ng; 10×PCR buffer 2.5μL;Taq E 0.04U/μL;Primer 0.36μmol/L;Mg²⁺ 2.0 mmol/L;dNTPs 0.15 mmol/L,in 25μl reaction solution.By analyzing the 6 factors and 5 levels,the results showed that the concentration of Mg²⁺,dNTPs and Random primer are the main factors,but the concentration of Mg²⁺ has the greatest effect on the experiment.Low concentration of dNTPs and random primer can reach the requirement.Two different DNA pools were prepared from equal volumes of standardized DNA by bulk segregant analysis(BSA).200 RAPD primers were screened from 10 series(A,B,C,D,F,G,K,N,T,W) produced by Saibaisheng Biotechnology Co.,Ltd.,13 primers produced distinct,reproducible,polymorphic profiles between the two bulks surveyed.The approximate size range of the RAPD products was 250bp to 1800bp. Reproducibility of the amplification pattern was checked by repeating each reaction at least twice without deliberate alteration in the protocol.Although a number of tickness-diagnostic RAPD bands were noted,most of them were either rather faint or not repeatedly found in all the representative individuals of the two bulks.Thus,a large number of potentially thick,informative RAPD bands were eliminated from consideration.In contrast,the primer T16 amplified a single,bright band of approx 1200bp from thin walnut pooling,which was absent in the thick walnut pooling.This band was named T16₁₂₂₄ and was amplified from all the five individuals,which was selected as putative thickness markers.The eluted fragments were ligated into pUCm-T Easy vector following the supplier's instructions,transformed into competent E.coli.strain cells(DH5α) and cultured.The plasmid DNA purified from the white colonies.Selected transformed clones were screened by PCR analysis with corresponding RAPD primer.A pair of SCAR primer was designed and synthesized by Invitrogen Biotechnology Co.,Ltd.One forward and one reverse primer were designed according to the result of sequencing by primer.The primers sequences were as follows:P1:GGTGAACGCTTAAAGAAGCTCCP2:GGTGAACGCTGCCAAGATATC...