| Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals. It is also infectious to human beings and follows with extensive interest as a zoonosis. Once FMD occurs, all the infected and exposed animals would be subjected to slaughter (OIE Manual, 1996). An economic devastation might result from the massive animal death and the economic sanction from other countries on account of the FMD. Therefore, prevention of FMD is the only way to solve the problem. Although the conventional vaccines made by chemically inactivated whole viral particle have been efficiently controlled FMD in many countries, it was found to cause outbreaks of FMD by release of incompletely inactivated virus from the vaccine. Attempts to produce safer vaccines for FMD have been made on the synthesized peptides or bacterially expressed proteins contain viral epitopes. Although antibodies induced by these pcptides or protein are able to efficiently neutralize the FMD virus in experimental animals, protection of livestock from virus challenge are not successful.PRV has some feature such as itcan not to infect people, the capacity of its genome is great, and the recombinant virus can descend stablely. so PRV can be reformed to be an live vim expression vector to express exogenous gene. It can construct bivalence or multivalence genetically engineering vaccine by put other nosogenics protective antigen gene into PRV which gene was deleted.In this experimentation, (he purpose gene is some linearity epi-position which lie on FMDV's proteinVP1..The purpose gene encode B cell pi-psilion that is VP1 14l-I60AA,00-2l3AA,and T cell pi-position these purpose genes are connected in series by flexibility amino acids CCCGGGAATTCGAGCTCGAATTCATGGTACCCTCGAGG The vector in this experimentation PRV TK-/gI-,we select the PK gene as the district of recombination.bccause the PK gene is an non-essential gene meanwhile it is an important non-essential gene, the deletion of PK gene can give rise to degrade of the recombint virous ,but no influence to the vimmunogenicily of PRV.The intermedial vectory is constructed by our laboratory. The method is take a fragment which include PK gene away from PRV genome, then put it into pPLOY-II vector, take the intermediate space of PK genie by using restriction enzyme Nde 1 and Sph I,then insert the purpse gene.The purpse gene can be expressed with fluorescin. the role of fluorescin is report gene, and it can be used into the screening of the recombinatc virous.In the experiment.we adopt this method that is take the plasmid and PRV genome into cotransfection. before the cotransfection we use restriction enzyme Asc I incide the plasmid, reclaim the large fragment, admix the fragment and viral genome with the hybrid scale 3:1.the intermediary agent which lake the mixture into PK cell is bangosome. Usually, we observe fluorescence after the cotransfection about 36 hours, choose the cells which emit fluorescence in series. A recent study showed that swines inoculated with DNA vaccine containing FMDV Site 1 were 100 per cent protected against the viral infection. Site 1, the predominant site, encodes two VP1 epitopes, which was able to protect animals from viral attack. The two epitopes are located at the positions from residues 141 to 160 and from 200 to 213 of Vpl, respectively. However, the plasmid DNA encoding epitopes from Site 1 combination with other four sites on PI was far from clear. Those four sites, like site 1 containing B-cell epitopes, were also defined on the type O virion through monoclonal antibody escape mutant studies. Site 3, encoding residues 40 to 60 of VP1, has been shown to modulate the function of epitopes encoded by site 1(Parry eta)., 1990). Moreover, Site 2(encoding residues 70 to 78 and 131 to 134 of VP2), Site 4 (encoding residues 56 to 58 on VP3) and site 5 (encoding residue 149) also made function differently.In this experimentation, we put the three linear epitope in series, and then recombinate them with eukaryotic expression vector pEGFP-cl, at last we get the recombinant plasmid pEGFP-cl-I-II-IU. In fact the recombinant plasmid is an gene vaccine ,we inject the recombinant plasmid into cavia cobaya, meanwhile set up positive control that is vaccinate cavia cobaya with FMDV inactivated vaccine, set up negative control by vaccinate cavia cobaya with vacant vector pEGFP-cl. Immunize cavia cobaya three times ,take blood from heart .detect the index of immunology. As shown by the result .the recombinant plasmid can stimulate organism give rise to cell immunity and humoral immunity ,and generate neutralization antibody. In this respect DNA vaccine is more efficient than proteinum vaccine. But the antibody titer which caused by the recombinant plasmid is lower than that caused by FMDV inactivated vaccine. The result may be due to the antigen which is expressed by the recombinant plasmid exist in the infected cell's cell-substance, so the antigen which is transmited to B cell is determinate, then the level of the antibody is low. The valency of humoral immunity which is caused by the recombinant plasmid is inferior to that which is caused by the inactivated vaccine, but we can promote immune effect of DNA vaccine by coexpress some immunomodulator(such as cell factor). This is the work to be going to of my experimentation. |