| The Lai navigation chicken, the landrace, the Dutch Stan cow were choosed as experiment animals, molecular clone technology was adopted to carry on the clone, and the sequence determination and analysis of N–terminal active sites of BPI in three kinds of animals . These experimental results provide the scientific theory and foundation for the further study of biology function of BPI gene in chicken, pig and cow, and the development of recombinant biology preparation which prevents GNB infectious deseases .1 Extraction of PMNs and RNAThe density gradient centrifuge was used to separate neutrophil granular cell (polymorphonuclear neutrophils,PMNs) of the pig and the cow, at the same time, The density gradient centrifuge process was improved to separate successfully PMNs of chicken; The results suggested that the buoyancy density of PMNs in chicken, pig, cow was repectively 1.085~1.090, 1.080~1.085, 1.080~1.086.Trizol Reagent was adopted to extract the RNA of PMNs, 28S and 18S RNA bands were found by 2.0% agarose gel electrophoresis, it indicated that extracted RNA was whole and meeted the need of RT-PCR extension; The OD values of all RNAs at wavelenghs of 260nm and 280nm were determinated by spectrophotometer , The ratio between the readings at 260nm and 280nm (OD260/ OD280 ) was respectively 1.8, 1.7, 1.9. The result suggested the purity of obtained RNA was very high and satisfied the following experiment.2 Primer design and RT-PCR extensionAccording to the gene sequence of BPI of the chicken, the pig and cow which registered in Genbank, three pairs of primers were designed respectively (chicken: P1 5' CGGAATTCATGCTGGCAAGGTCTGGAGG 3' ,P2 5' ATAAGAATGCGGCCGCCCGGGACCACGGAT 3';Pig:P3′GCGTCGACATGACTTTGACCTGAGTGTGGAGG 3′, P4 5′CGAAGCTTCAGGCTGCTGCCGGACGT 3′; Cow: P5 5′ACCAACCCTGGCATTGTC 3′P6 5′AGACTCGATTCGTTTGCG 3′). For the purpose of the directional clone and the appraisal of BPI, EoR I and Not I sites and the corresponding protection basic group were designed at 5′-terminal of P1, P2 . Reverse-transcription polymerase chain reaction (RT-PCR) was firstly adopted to synthesize the first chain of cDNA of BPI gene in the chicken, the pig, and the cow, then cDNA was extended by PCR. The electrophoresis was used to analyse the RT-PCR products of BPI gene, Results showed that the specific bands were found in 280bp, 140bp, 500bp.3 Clone and the identification of BPI gene in chickenRT-PCR products of BPI gene in chicken were purified, then were inserted to multiple cloning sites of pMD-18 plasmid vector, formed recombinant pMD-18-BPI plasmid, which was transformed to E.coli DH5α, positive clone plasmid was screened with Amp resistance screening . In order to confirm the presence of foreign gene, positive recombinant plasmid was identified with EcoR I, Not I double enzyme cut ting, the electrophoresis results demonstrated that the anticipated size (284bp) gene fragment was obtained; and was appraised by PCR, specific band about the 280bp size was found with the electrophoresis. These results strongly suggested that the BPI gene was inserted to pMD-18 plasmids and recombinant plasmid was constructed successfully.4 Sequence determination and analysis of BPI geneThe recombinant plasmid (pMD-18-BPI) of chicken and RT-PCR products of the BPI gene of pig and cow were all sequenced. The data obtained suggested that the N-terminal gene fragments of BPI which were extended from RNA of PMNs in all tested animals were obtained, but the size of fragments was different, about 284bp , 144bp ,and 500bp was respectively found in chicken, pig and cow. The determined sequence results were analysed with BLAST, results showed that three basic groups mutated in chicken, two basic groups mutated in cow and the rest was consistent with those of the reports , no mutation was found in pig. But BPI amino acid sequence of three kinds of animals was respectively consistent with that of the reports . The DNAstar analysis software was adopted to analyse obtained gene fragments, results showed that homology of N-terminal amino acid sequence of BPI between the pig and the cow was 86% and 75%, but among the chicken, the pig and the cow was very low.These results suggest that PMNs in chicken be successfully extracted with improved density gradient centrifuge; and N-terminal partial gene sequence of BPI in chicken, pig ,and cow be also successfully cloned . |