| Blast, bacterial blight and planthopper are the important diseases or insect pests in rice production. Development of resistant varieties was considered to be the most effective, efficient and environment-friendly strategy controlling the diseases and pests. However, the resistant varieties in use could only resist to one or two diseases or pests and the resistance was conferred by single major gene. Most of them would be broken down after 3-5 year's release. Therefore, development of multi-resistant varieties was the hot issue in resistance breeding. Establishment durable resistance was the key problem.In this study, the integrating technology of anther culture, MAS and backcross was developed and successfully used in transferring xa-5, a recessive gene for resistance to bacterial blight, from IRBB5 to Wu Feng Zhan 2(WFZ2). Gene pyramiding lines resistance to bacterial blight, blast and planthopper were obtained. The results were as follows:1. Segregation Population derived from IRBB5 with a recessive gene for resistance to bacterial blight and Shuhui 162 was inoculated with bacterial blight pathogen Zhel73. The inoculation demonstrated one major recessive gene segregation ratio. The bacterial blight resistance of WFZ2 was controlled by minor-polygene. The character conformed to additive-dominant model and was mainly controlled by additive effects.2. In the B1F1 population of WFZ2 and IRBB5, 68.3% plants got the bacterial blight resistance as recurrent parent WFZ2. It indicated that the plants with the same resistance level to WFZ2 and xa-5 gene could be obtained through one time backcross.3. A new revise primer, 5' CCAGACACCACTGCACATTC3' , was designed according to the sequence of P0574H01 in Gene Bank using Primer3. With a rational GC ratio, the new revise primer had a similar Tm to the forward one. The PCR amplification efficiency was greatly improved. Unfortunately, the sequence comparison of two parents indicated that they were too similar, about96%, to design tri-primer to amplify. To simplify the PCR procedure, other method should be taken.4. One thousand five hundred and thirty six calli and 62 green plantlets were obtained with 6.0% callus induction frequency and 0.24% green shoot regeneration frequency. The green shoot regeneration frequencies were 0.37% with PPA-based one-step medium, 0.21% with M8 medium and 0.14% with SH medium. It indicated that the PAA based one-step medium was most effective in the anther culture of indica genotypes.5. The integrating technology of anther culture, MAS and traditional backcross was efficient in multi-resistant breeding, only two years from the cross to the pure lines with multi-resistance.6. Three multi-resistant lines with xa-5 and minor-polygene for bacterial blight and resistance to rice blast and planthopper were obtained. Among of them, W2 showed high resistance to bacterial blight, resistance to blast and planthopper.7. Quality test of W2 showed that: among of the 11 quality standards, there were 5 similar to WFZ2 and 6 were improved, namely chalky grain from 22% to 1%, chalkiness from 4.2 to 0.4, translucency from 3 to 1, alkali spreading value from 3.2 to 7.0, gel consistency from 59mm to 78mm and amylose content from 14.5% to 18.4%. It indicated that some defective characters in WFZ2 could be sorted out through one time backcross and high quality line with multi-resistant genes could be obtained. |