| 1 BackgroundAcute coronary syndrome(ACS)is a group of diseases characterized by erosion or rupture of coronary atherosclerotic plaque,secondary formation of plaque surface thrombosis and/or distal thromboembolism,resulting in complete or incomplete myocardial ischemia.According to the epidemiological report in 2016:there are 290 million cardiovascular disease patients in China.In 2015,cardiovascular disease death was the leading cause of total death of urban and rural residents,accounting for 42.61%in urban areas and 45.01%in rural areas,among which ACS accounts for nearly 50%,and the age of onset of ACS is gradually tending to be younger.According to the universal definition of myocardial infarction(the Third Edition),ACS can be divided into ST segment elevation myocardial infarction(STE-ACS)and non ST segment elevation ACS(NSTE-ACS).Coronary artery thrombosis and/or thromboembolism are the main pathogenic factors of ACS,and the rupture of vulnerable plaque is the basis of ACS attack.Therefore,it is of great clinical significance to study the molecular and cellular biological mechanism of vulnerable plaque and explore new biomarkers to predict the vulnerability of atherosclerotic plaque,which can reduce the occurrence of acute coronary syndrome and the occurrence of severe cardiovascular events.Macrophages,monocytes and their inflammatory responses play an important role in plaque progression.Macrophages and monocytes can swallow cholesterol particles,play an important role in the formation and death of foam cells and the formation of necrotic core,and participate in inflammatory reaction and plaque rupture,thus speeding up the progress of plaque rupture.Recent studies have shown that the mechanism of macrophage and monocyte aggregation in plaque may be local cell proliferation(rather than infiltration).In addition,neutrophil derived cathelicidins can induce the adhesion of circulating monocytes,which indicates that neutrophils may participate in vascular inflammation before monocytes.Inflammatory mediators associated with leukocyte activation may also be involved in the progression of atherosclerotic diseases.Interleukin-6(IL-6)can stimulate activated leukocytes and smooth muscle cells to secrete C-reactive protein.Studies have shown that the asp358ala allele variation of IL-6 receptor is a risk factor for coronary heart disease,suggesting that IL-6 signaling pathway plays an important role in the process of atherosclerosis.Interleukin and other related inflammatory factor signaling pathways are closely related to the occurrence and progress of atherosclerosis.However,the exact molecular mechanism is still unclear.Interleukin enhancer binding factor 3(ILF3),a double stranded RNA binding protein,is involved in DNA metabolism,transcriptional regulation,translation,RNA stabilization and microRNA processing and localization.Recent studies have shown that it may play a physiological role in ACS,including early myocardial injury,thrombosis,stroke,inflammation and dyslipidemia.However,little is known about its role in the vulnerability of atherosclerotic plaque.Meanwhile,the clinical value and potential pathological mechanism of ILF3 as a biomarker for predicting the risk of ACS in the general population are still unclear.In this study,we explored the role of ILF3 in the vulnerability of atherosclerotic plaque in human serum samples and plaque tissue of patients with coronary stenosis.Meanwhile,we predicted acute coronary syndrome by serum ILF3,which provided a new target for early clinical detection and diagnosis of ACS.2 Objectives(1)To measure the expression of ILF3 in atherosclerotic vulnerable plaques;(2)To measure serum concentration of ILF3 in patients with acute coronary syndromes;(3)To elucidate the potential impact of ILF3 in atherosclerotic plaque vulnerability to improve the early detection and appropriate intervention of ACS3 MethodAn expanded Methods is available in the online-only Data Supplement3.1 Study populationThe overall study design is shown in Supplemental Figure S1.The research protocol was approved by the regional ethics committee(KYLL-201 8(KS)-233);all study participants provided written informed consent.AMI was defined as recommended in current guidelines.1 7-20 UA was diagnosed in patients with normal troponin T levels and typical angina at rest,a sudden increase in episodes of a previously stable angina,and in cases of positive cardiac exercise testing or cardiac catheterization with coronary arteries showing stenosis of 70%.Pre-defined further diagnostic categories included cardiac but not coronary symptoms(e.g.,perimyocarditis,tachyarrhythmias)and noncardiac symptoms.If AMI was excluded in the ED,but no sufficient further diagnostic procedures were performed for conclusive diagnosis,symptoms were classified as of unknown origin3.2 Measurements of serum ILF3 hs-TnIThe levels of ILF3 were measured from 10-mL peripheral venous blood samples(pyrogen-free tubes without additives)in duplicate by enzyme immunoassay(Code No.LS-F19676-1,LifeSpan BioSciences;WA,USA).Intra-and interassay coefficients of variation were low at 3%each,and the lower detection limit was 1.6 pmol/L.hs-TnI levels were measured with a prototype cardiac troponin I assay(Architect STAT High-Sensitive Troponin,Abbott Diagnostics,Shanghai,China)19,20,which can detect troponin I in 96%of the reference population,and has a recommended 99th percentile cut-off of 26.2 pg/mL,or 34.2 pg/mL for men and 15.6 pg/mL for women20.3.3 Clinical sample collectionThe coronary arteries from patients with extensive atherosclerotic disease and healthy controls(three specimens each from Shandong Red Cross Society)were evaluated.Carotid plaques were obtained from 15 consecutive patients(nine males,six females)who underwent high-grade carotid stenosis from endarterectomy at QILU Hospital.Written informed consent was obtained from each patient,and ethics approval was obtained from the Ethics Committee of the QILU Hospital prior to sample collection.Human carotid artery segments from atherosclerosis lesions as determined by carotid ultrasound were obtained from carotid endarterectomies,fixed in neutral buffered formalin,and embedded in paraffin for immunohistochemistry.3.4 Immunohistochemical and immunofluorescence stainingAtherosclerotic plaque morphology and collagen content were examined in 8-mm-thick sections stained with hematoxylin and eosin and Masson’s trichrome,respectively.For 3,3-diaminobenzidine staining,paraffin-embedded tissue sections were deparaffnized and stained with an antibody,followed by a biotin-conjugated secondary antibody(1:1 000),and then by horseradish peroxidase-conjugated streptavidin(Dianova,Rodeo,CA).Macrophages were identified using anti-Mac-3(a marker for murine macrophages).For immunofluorescence,sections were deparaffnized and stained with specific antibodies,followed by fluorescence-labelled secondary antibodies.The nuclei were counterstained with 4,6-diamidino-2-phenylindole(DAPI).Specific fluorescence imaging was acquired by laser-scanning confocal microscopy(LSM710,Carl Zeiss,Germany)3.5 Statistical analysisIn the discovery cohort,baseline characteristics were compared between those with and without 70%coronary stenosis in at least one major coronary artery.Comparisons of dichotomous variables(sex,history of diabetes,etc.)among the AMI,UA,and healthy control groups were compared using the Fisher exact test;continuous variables(BMI,biomarkers,etc.)were compared using the Wilcoxon rank sum testReceiver operating characteristic(ROC)curves were determined for the prediction probabilities of ILF3 and hs-cTnI,and a logistic regression model was used to evaluate the risk of disease.To evaluate the diagnostic value of ILF3 and hs-cTnI,cut-off points were selected using the discovery cohort ROC curves at a sensitivity of at least 85%.The corresponding sensitivity,specificity,and accuracy were determined using the validation cohort.To eliminate multicollinearity of the data,we log-transformed the values of biomarkers and removed some variables with a large variance inflation factorAll experiments were performed independently at least three times.R version 3.5.0 software(R Foundation for Statistical Computing,Vienna,Austria),with the pROC 23 and ggplot2 packages,24 was used for all analyses.All tests were two-sided and the significance level was set at 0.05.4 Results4.1 Study flowchartA total of 526 ACS patients and 210 healthy controls were enrolled and divided into a retrospective study cohort and a prospective study cohort.The retrospective cohort consisted of 150 UA patients,150 AMI patients,and 85 healthy controls.We will construct a diagnosis system of ACS with ILF3 change through retrospective study cohort.After screening the best diagnostic threshold,we will verify it in prospective study cohort.The prospective study cohort consisted of 155 UA patients,75 AMI patients and 125 healthy controls.All enrolled patients were recruited from four different emergency departments and blood samples were collected.Biomarkers were measured and correlated with the final diagnosis and subsequent hospitalization.The specific process is shown in Figure 14.2 Changes in ILF3 levelsThe study found that compared with healthy control group,the concentration of ILF3 in serum of ACS patients was significantly higher than that of healthy control group,increased by more than 23 times,there was a significant difference.There were 155 patients with unstable angina pectoris(UA)and 71 patients with acute myocardial infarction(AMI).Although the level of ILF3 in UA patients was slightly higher than that in AMI patients,the difference was not statistically significant.In the four diagnostic centers,the relative difference of ILF3 level in the diagnosis group was basically the same.There are no uncertain results and there are no restrictions on outliers.ILF3 levels at presentation in the validation cohort.4.3 Predictive accuracy of the ILF3 assayThe area under the ROC curve(AUC)was used to quantify the prediction accuracy of serum ILF3.For all ACS patients,UA patients and AMI patients,the prediction accuracy of ILF3 was very high.The accuracy of ILF3 combined with HS cTnI(ILF3+ HS cTnI)was 0.99,which was significantly higher than that of HS cTnI alone(P<0.001).The area under the curve(AUC)analysis of ILF3+HS cTnI combined diagnosis showed that the accuracy of combined diagnosis of UA by ILF3+HS cTnI was significantly higher than that of AUC using HS cTnI alone to predict UA risk.The accuracy of predicting AMI by ILF3,HS cTnI and ILF3+HS cTnI was similarThe optimal clinical decision limit was determined according to ROC curve.The positive diagnostic value of ILF3 and HS cTnI in ACS.These diagnostic values were then applied to predict ACS,UA and AMI in the validation cohort,showing high sensitivity(>84%)and 100%specificity in all ACS cases;except for sensitivity,ILF3’s predictive performance indicators for ACS were not lower than HS cTnI.More importantly,the negative predictive value of ILF3 for ACS was higher than that of HS cTnI4.4 There was no significant correlation between serum ILF3 level and myocardial injury in ACS patientsCompared with HS cTnI,the changes of serum ILF3 level in ACS patients did not increase with the prolongation of chest pain attack time,which indicated that the increase of serum ILF3 in ACS patients was not related to the severity of myocardial cell necrosis,indicating that ILF3 was not a specific biomarker of myocardial cell necrosis.ILF3 and hs-cTnI levels at presentation in relation to time since the onset of chest pain4.5 The level of ILF3 had no significant correlation with the severity of coronary atherosclerosisWe evaluated whether elevated serum ILF3 levels were associated with angiographic severity of coronary artery disease in ACS patients.In the discovery cohort,the angiographic data of 300 patients with ACS were analyzed for the degree of vascular stenosis,and the degree of single vessel disease,double vessel disease and multi vessel disease.It was found that serum ILF3 level had no significant correlation with the degree of coronary artery stenosis(by Gensini score)and the diseased vessels These data suggest that the increase of serum ILF3 level in ACS patients can not reflect the severity of coronary atherosclerosis,but may be the validation change of coronary atherosclerotic plaque4.6 the content of ILF3 was significantly correlated with inflammatory factorsIn order to determine the clinical significance of elevated serum ILF3 and HS cTnI,we used logistic multiple regression analysis to evaluate the correlation between ILF3 and HS cTnI and the risk factors of atherosclerosis,such as age,gender,smoking,serum total cholesterol and some inflammatory cytokines.The results showed that the increase of serum HS cTnT was closely related to coronary heart disease and IL-6,while the increase of ILF3 was closely related to gender,diabetes mellitus,statins treatment,IL-1β,IL-6 and TNF α.These results suggest that the increase of serum HS cTnT is a marker of myocardial injury in ACS patients,and the increase of ILF3 is more likely to be related to the degree of inflammation in as plaque4.7 ILF3 is upregulated in human atherosclerosis and localized in foam cellsImmunofluorescence and immunohistochemical staining of human coronary artery showed that ILF3 expression was significantly higher in atherosclerotic plaques than that in non atherosclerotic vascular tissues,and a large number of ILF3 was expressed in the necrotic core area.In addition,we found the co localization of ILF3 and iNOS(M1 macrophage biomarker)was observed in macrophages,indicating that ILF3 was expressed in inflammatory M1 macrophages of plaque5 Conclusion:ILF3 may be used as a new biomarker to predict the rupture of atherosclerotic plaques and provide early diagnosis for patients with acute coronary syndrome.1.BackgroundVulnerable plaque in coronary artery refers to the plaque which is unstable,easy to form thrombus,and suddenly leads to acute heart events.Thrombosis of vulnerable plaque is an important pathogenesis of acute coronary syndrome(ACS).It can be manifested as plaque rupture secondary to thrombosis,or plaque erosion or calcified nodules and other lesions induced thrombosis.Pathologically,plaque rupture is the fibrous cap defect of lipid plaque and extends to the lipid core.There are often non occlusive thrombus composed of platelets and fibrin.The ruptured lipid plaques are often accompanied by thin fibrous cap and large lipid core.There are a lot of macrophages infiltrating in the fibrous cap,and the lipid core is rich in cholesterol crystals.Recent studies have shown that macrophages are the central link in the pathogenesis of ACS.The degradation of fibrous cap matrix by macrophages is an important factor affecting plaque vulnerability.The determination of macrophage content in fibrous cap can evaluate the stability of atherosclerotic plaqueInterleukin enhancer binding factor 3(ILF3),a double stranded RNA binding protein,has been shown to regulate cell metabolism,including transcriptional regulation,mRNA processing and localization.Recent studies have found its possible physiological roles in ACS,including early myocardial injury,thrombosis,stroke,inflammation and dyslipidemia.However,little is known about its role in atherosclerotic plaque vulnerabilityIn the previous study,we found that the serum level of ILF3 in ACS patients was significantly increased,and the expression of ILF3 in atherosclerotic plaques was significantly increased,and it was localized in macrophages,We used macrophage specific overexpression of ILF3 in mice and mouse primary macrophages to clarify the potential impact of ILF3 on atherosclerotic plaque vulnerability,and further explore the mechanism of atherosclerotic plaque vulnerability.2.Objectives1.Establish atherosclerosis model of ILF3f/f/lyzMCre/ApoE-/-mouse and observe the role of ILF3 in plaque vulnerability;2.Illuminate the role of ILF3+macrophages in atherosclerotic plaques.3 Method3.1 Construction of ILF3f/f/lyzMCre/ApoE-/-.All animal experiments were performed according to the protocols approved by the Institutional Committee for the Use and Care of Laboratory Animals.Apolipoprotein E-deficient(ApoE-/-)mice were obtained from the Department of Laboratory Animal Science,Peking University Health Science Center.ILF3 conditional knockout transgenic mice(ILF3f/f mice)were generated with the combined use of CRISPR/Cas9 and Cre/LoxP,and purchased from Beijing View Solid Biotechnology.LyzMCre(all C57BL/6 background)transgenic mice were kindly provided by Dr Wen-cheng Zhang(Shandong University).To generate macrophage-specific ILF3 transgenic mice(ILF3M-Tg),the F1 Lyz2cre/+ILF3floxed/+genotype was backcrossed with Lyz2+/+ILF3floxed/floxed mice to generate Lyz2cre/+ILF3floxed/floxed mice.Lyz2+/+ILF3floxed/floxed mice were considered the wild type(WT)control.ApoE-/-ILF3M-Tg mice were generated by crossing ILF3M-Tg mice with ApoE-/-mice(C57BL/6 background).ILF3 macrophage-specific overexpression mice in an ApoE-/-background were generated by crossing crossbred with ApoE-/-mice to form ILF3f/f/lyzMCre/ApoE-/-.Polymerase chain reaction(PCR)of tail-tip DNA was used to verify the genotypes.3.2 Unstable plaques atherosclerosis model induction and treatmentEight-week-old male ApoE-/-and ILF3f/f/lyzMCre/ApoE-/-mice were fed a high-fat Western diet(WD,Teklad Adjusted Calories 88137:21%(wt/wt)fat;0.15%(wt/wt)cholesterol;19.5%(wt/wt)casein;no sodium cholate)for 4 weeks;a cuff was implanted around the right carotid artery and the high-fat diet was continued for 12 weeks.The mice were intraperitoneally(i.p.)injected with lipopolysaccharide(LPS;Sigma-Aldrich,St Louis,MO,USA)or control saline the week before sacrifice(single dose of 5 μg LPS per mouse/day,N=15 per group).3.3 Macrophage isolation and Oil-red-O stainingPeritoneal macrophages were harvested from the peritoneal lavage of WT and ILF3M-Tg mice 7 days after i.p.injection of 100%paraffin oil.The cells were washed in phosphate-buffered saline(PBS)and cultured overnight in Dulbecco’s modified Eagle medium(with 10%foetal bovine serum)and stimulated with oxidized low-density lipoprotein(oxLDL;50 g/ml;Peking Union-Biology Co.,Ltd.)for 24 h to evaluate whether the expression of ILF3 on macrophages is regulated by lipoproteins.The cells were fixed with 4%paraformaldehyde,washed with PBS,and stained with Oil-red-O for 20 min at 37℃.The Oil-red-O content was quantified with Image-Pro plus software.3.4 Immunohistochemical and immunofluorescence stainingAtherosclerotic plaque morphology and collagen content were examined in 8-mm-thick sections stained with hematoxylin and eosin and Masson’s trichrome,respectively.For 3,3-diaminobenzidine staining,paraffin-embedded tissue sections were deparaffnized and stained with an antibody,followed by a biotin-conjugated secondary antibody(1:1 000),and then by horseradish peroxidase-conjugated streptavidin(Dianova,Rodeo,CA).Macrophages were identified using anti-Mac-3(a marker for murine macrophages)For immunofluorescence,sections were deparaffnized and stained with specific antibodies,followed by fluorescence-labelled secondary antibodies.The nuclei were counterstained with 4,6-diamidino-2-phenylindole(DAPI).Specific fluorescence imaging was acquired by laser-scanning confocal microscopy(LSM710,Carl Zeiss,Germany).3.5 Immunoblot analysisFor immunoblotting,proteins were separated with 10%sodium dodecyl sulphate-polyacrylamide gel electrophoresis and then transferred to a nitrocellulose membrane,The membranes were then blocked with 5%non-fat milk in PBS with 0.1%Tween-20 for 1 h,incubated for 1 h with primary antibodies,followed by incubation with horseradish peroxidase-conjugated secondary antibodies at room temperature for 1 h.The bound primary antibodies were detected by chemiluminescence(Milipore,Billerica,MA,USA),and quantified by Image J software(NIH,Bethesda,MD,USA).Expression levels were normalized to the control.3.6 RT-PCR Total RNA was extracted using Trizol reagent(Invitrogen)and reverse-transcribed into cDNA.SYBR Green-based RT-PCR was performed using a sequence detector system(IQ5 Real-Time PCR cycler,Bio-Rad Laboratories,CA,USA).Relative expression levels were normalized to that of β-actin.3.7 Flow cytometrySince oxLDL was reported to trigger the M1 polarization of macrophages,thereby inducing and promoting inflammation in the pathogenesis of atherosclerosis,3 peritoneal macrophages were treated with 50 μg/ml oxLDL and the markers of the M1 and M2 subtypes were evaluated by flow cytometry.Peritoneal macrophages(2 ×105/well)were plated and incubated with ox-LDL for 24 h.For analysis of CD86-and CD209-positive cells in response to ILF3 overexpression,the cells were incubated with mouse monoclonal non-conjugated anti-CD86 and anti-CD209 antibodies(1:1000)(Abeam,Cambridge,UK)for 30 min at 4℃ in the dark.After washing with PBS three times,the cells were labelled with secondary rat anti-mouse PerCP-Cy5-5-A and APC-A(Abeam,Cambridge,UK)at 4℃ for 30 min.The labelled cells were washed,collected,and analysed using a FACS flow cytometry system.3.8 Construction of arginase 1 promoterThe argl promoter sequence was queried through the sensitive website,and the argl promoter sequence from-560bp to-210bp was selected for analysis.The Arg-1 promoter fragment was synthesized and constructed into pGL3 basic by using the method of segment by segment deletion.The sequence was-260 bp,-310 bp,-360 bp,-410 bp,-460 bp,-510 bp,-560 bp,respectively3.9 Luciferase assayCell lysate was prepared,and lysate was added to ice to lyse cells,and then centrifugally transferred to a new centrifuge tube for standby.After that,the cell lysate was treated according to the instructions of luciferase kit and detected by photometer in time.Results analysis:the ratio of fire luciferase activity value to internal reference β-gal activity value was calculated,and t test was used for data analysis,P<0.05 was considered as statistically significant.3.10 Chromatin immunoprecipitation(1)Cell preparation:According to the requirements of the kit,a certain amount of cells were prepared for chip experiment(2)Chip experiment was completed step by step according to the instructions of millipore chip kit3.11 ILF3 interferes with the construction of lentivirus vectorsBoshang Biological Company was responsible for the synthesis and construction,the interference sequence was GCCAATGGACTGAAGTCATGT,and the loop was TTCAAGAGA3.12 Statistical analysisAll experiments were performed independently for at least three times.R version 3.5.0 software(R Foundation for Statistical Computing,Vienna,Austria),with the pROC 21 and ggplot2 packages,22 was used for all analyses.All tests were two-sided and the significance level was set at 0.05.4 Results4.1 establishment of the macrophage specific overexpression of ILF3 miceAs shown in the figure,ILF3 systemic loxP mice synthesized by the company were hybridized with macrophage cre(Lyz2 CRE)mice to obtain ILF3m-Tg mice,and the mice were hybridized with ApoE-/-mice to obtain ApoE-/ILF3m-Tg mice.4.2 macrophage specific overexpression of ILF3 in mice ApoE-/-ILF3m-Tg mice were successfully constructed and identified4.3 ILF3 promotes foam cell formation.In wild-type peritoneal macrophages,the protein level of ILF3 increased with the increase of oxLDL dosage and treatment time.Oil red O staining showed that the macrophages of ApoE-/-ILF3m-Tg mice had significantly higher uptake of oxLDL than those of ApoE-/-control mice.Compared with wild-type mice,the macrophage lipid phagocytosis-related genes HMGCR,CD36 and ABCA1 in ApoE-/-ILF3M-Tg mice were significantly higher.4.4 macrophage specific overexpression of ILF3 aggravates the formation of atherosclerosis in miceCompared with the ApoE-/-mice fed for 12 weeks,the atherosclerosis in the aortic sinus and aorta of ApoE-/-ILF3m-Tg mice was significantly increased4.5 macrophage specific overexpression of ILF3 aggravates the vulnerability of atherosclerotic plaqueThe results of plaque morphology analysis showed that the atherosclerotic plaques of ApoE-/-ilf3m TG mice contained large necrotic core,collagen content and smooth muscle cell number were significantly decreased,and there were more macrophage infiltration in the plaques of ApoE-/-ILF3m-Tg mice4.6 macrophage specific overexpression of ILF3 enhances angiogenesis in atherosclerotic plaqueCompared with ApoE-/-mouse foam cell regions,ILF3 overexpression region showed a large number of VEGF expression.However,in the regions with high ILF3 expression,the number of microvessels per unit area increased significantly4.7 up regulation of ILF3 enhances oxLDL induced polarization of pro-inflammatory M1 macrophagesThe results of flow cytometry showed that the percentage of CD86 positive cells(M1)in ilf3m TG macrophages increased significantly.No significant changes of CD209 positive cells(M2)were detected after oxLDL treatment.4.8 overexpression of ILF3 aggravates inflammatory expression in atherosclerotic plaques.Compared with ApoE-/-mice,the expression of iNOS in ILF3m-Tg atherosclerotic plaque was significantly higher in ilf3m TG mice than in ApoE-/-mice.The results showed that the over expression of ILF3 in macrophages was promoted by oxLDL Inflammatory M1 macrophages were polarized.4.9 overexpression of ILF3 increased the expression of inflammatory factors in macrophages.The results showed that the transcription of anti-inflammatory gene,pro-inflammatory gene and anti-inflammatory gene were increased after stimulated peritoneal macrophages with oxLDL for 24 hours.Compared with wild-type control,the mRNA levels of argl and IL-10 in ILF3 overexpressed macrophages were significantly decreased(P<0.001 or 0.01),while the expressions of IL-6,TNF-α,iNOS and IL-1 β were significantly increased.4.10 ILF3 regulates the transcription and expression of arginase 1 The results showed that ILF3 overexpression was successful,and the interference effect of silf3 was obvious.ILF3 overexpression or ILF3 interference affected the activity of p65 and STAT1 and the expression of argl;the effect of ILF3 overexpression and ILF3 interference on argl mRNA level was consistent with that of protein level;double fluorescence reporter gene showed that ILF3 regulated the activity of Arg-1 promoter-460～-410 region;chromatin immunoprecipitation(chip)The results showed that ilf-3 could bind to arginase-1 promoter directly.5 Conclusion(1)ILF3+macrophages enhance oxLDL uptake and promote foam cell formation and atherosclerosis.(2)ILF3+macrophages upregulated proinflammatory cytokines and downregulated the antiproinflammatory cytokines to promote atherosclerosis.(3)ILF3+macrophages facilitates atherosclerotic plaque formation and increases the vulnerability of atherosclerotic plaque formation by enhancing macrophage retention(4)ILF3 in macrophages can directly bind to the promoter region of arginase-1,thus inhibiting the transcription and expression of arg1,and regulating the polarization of M1 type macrophages.1 BackgroundAbdominal aortic aneurysm(AAA),as a chronic vascular degenerative disease,is characterized with a progressive dilation and remodeling of the vessel wall,leading to a lethal risk of aortic rupture,especially in the elderly.However,the pathogenesis of AAA is still not fully explained.Although there are some common features between AAA and atherosclerosis,the medical treatment for coronary artery disease are not available to reduce AAA formation or expansion in human,and currently the principle therapy still depends on surgical interventions.Recent evidence indicated that chronic inflammation played a critical role in the pathogenesis of AAA,and inhibition of inflammatory response may be a therapeutic approach for the prevention of AAA.4Cyclooxygenase-2(COX-2),a key regulator enzyme of prostaglandins(PGs)synthesis,catalyzes the conversion process of arachidonic acids to PGs.COX-2 modulates pro-inflammatory chemokines expression,influences cell proliferation and functions.COX-2 was normally undetectable in most human tissues,but it could be rapidly induced in response to inflammatory stimuli,such as lipopolysaccharide(LPS)or angiotensin Ⅱ(Ang Ⅱ).The expression of COX-2 is well-characterized in chronic inflammatory disorders,such as atherosclerosis.10 Genetic knockout of COX-2 resulted in significant attenuation of acute inflammation corresponding with decreased PGE2 levels.11It has been demonstrated that immune system took part in the pathogenesis of many cardiovascular diseases.CD4+CD25+regulatory T cells(Tregs),as an important component of the immune system,maintained immunological homeostasis and tolerance,and prevented excessive immune responses.An impaired function or a deficiency of Tregs can result in immune dysregulation and autoimmune disease.It has been documented that Tregs have a protective role in many cardiovascular disease,including atherosclerosis,hypertension,myocarditis and dilated cardiomyopathy Recently,Tregs have been showed to prevent the development of Ang II induced AAA in miceCurrently,little is known about the correlation between Tregs and COX-2 in AAA.Therefore,by use of an AAA model,we attempt to investigate the potential mechanism and look for an immune treatment of AAA2 Objectives(1)To clarify the protection of Tregs against AAA;(2)To clarify the correlation between Tregs and the expression of COX-2 both in vivo and in vitro3.Materials and Methods3.1 Animal models and interventionAnimal experiments were approved by ethics committee of Shandong University and complied with the guidelines of the Animal Management Rules of the Chinese Ministry of Health.Ten C57BL/6J wild type mice(male,8 weeks old)were obtained from the Beijing University Animal Research Center(Beijing,China)and used as donors of Tregs.A CD4+CD25+Regulatory T Cell Isolation Kit(Miltenyi Biotec,German)was used to obtain Tregs from the splenocytes of C57BL/6J mice according to the manufacturer’s instructions.Purified Tregs were suspended in phosphate buffered saline(PBS,200μl)for further injectionThirty male ApoE-/-mice(3 months old)on a C57BL/6J background were housed in pathogen free condition and kept on a 12 hour light/12 hour dark cycle.During the entire experimental period,all ApoE-/-mice were fed with a high fat diet(0.25%cholesterol and 15%cocoa butter)and had full access to food and water.These mice were randomly divided into three groups(n=10 per group):the control group(received no treatment),the PBS group(received an intravenous injection of PBS),and the Tregs group(received an intravenous injection of 106 Tregs).One day after injection,Ang II(1000 ng/kg/min)was continuously infused for 28 days via a mini-osmotic pump as described previously.PBS and Tregs were injected repeatedly after 2 weeks.After 28 days of Ang Ⅱ infusion,all mice underwent euthanasia and their aortic tissues were collected.3.2 Histological analysisEuthanized mice were perfused with saline to eliminate blood in the lumen,and the aortic arteries were removed and fixed in 4%paraformaldehyde.The formation of AAA was evaluated by measuring the maximum external diameter of abdominal aorta,which defined as at least 50%dilation.Then,the abdominal arteries were embedded in OCT compound and serial sections(5 μm)were cut for hematoxylin and eosin(H&E)staining or immunohistochemical staining to assess the expression of COX-2(1:500,Abeam,MA,USA).Positive staining areas of COX-2 were digitally captured and calculated by a computer-assisted automated image analysis system(Image Pro Plus 6.0,Media Cybernetics,USA).3.3 ImmunofluorescenceAfter blocked with BSA for 30 min,sections(5 μm)of abdominal arteries were incubated with rabbit anti-COX-2(1:100,abeam,MA,USA),mouse anti-CD68(1:100,abeam,MA,USA)or mouse anti-a-SM-actin(1:100,Sigma-Aldrich,MO,USA)overnight at 4℃.After incubated with secondary antibodies,a drop of Prolong Gold anti-fade reagent with DAPI(Vector Laboratories,CA,USA)was used to seal the coverslip.Images were acquired by laser scanning confocal microscopy(LSM 710,Zeiss,Germany)3.4 Cell co-culture and treatmentIn the first part of in vitro study,the RAW264.7 mouse macrophages(Manassas,VA,USA)cultured in DMEM medium(GIBCO,Grand Island,NY)containing 10%fetal bovine serum,100 U/ml penicillin and 100 g/ml streptomycin at 37℃ in 5%CO2.Macrophages were randomly divided into three groups:the control group,the CD25-group(CD4+CD25-T cells,5×105),and the Tregs group(Tregs,5×105)for 48 h with anti-CD3 antibody(50 ng/ml).Then cells were stimulated with Ang Ⅱ(1μM)for 24h.Floating T cells were discarded and macrophages were harvested f... |
PDF Full Text Request