Rab11 Functions As An Oncoprotein Through NF-κB Signal Pathway In Bladder Cancer

Objective:Bladder cancer is one of the most common human malignancies.It ranks as the most common form of bladder cancer with increasing incidence.It ranks as the ninth highest malignant tumor in women and the fourth highest malignant tumor in men in the United States.Bladder cancer is also the most lethal for of malignant tumor of the genitourinary track in China.Approximately 70%of BLCA is non-muscle invasive bladder cancer（NMIBC）and about 30%of BLCA is muscle invasive bladder cancer（MIBC）which presents the poor prognosis.Despite development of conventional therapies during the past decades,it is still important to find new molecular targets and develop new targeted therapy to achieve long-term patient survival.Growing evidences indicate Rab protein as an essential factor in the process of endocytosis.Rab is a family of small molecule GTPase which functions as a regulator of protein trafficking,vesicular transport,membrane targeting and fusion.Vesicle trafficking and dynamics are essential for regulation of crucial cell behaviors linked with cell migration and tumorigenesis.Rab11,which functions as a recycling endosome and vesicle trafficking proteinvesicle trafficking protein vesicle trafficking protein,has been shown to control the sensing of the relative levels of Rac activity,leading to the organization of individual cells in a coherent multicellular motile structure.Rab11 also contributes to mitotic spindle organization and orientation.The function of Rab11 in human cancers has not been well studied.It has been reported that Rab11 up-regulated E-cadherin to induce the transformation of colorectal cancer cells,suggesting Rab11 may function as an oncoprotein.However,its expression pattern has not been studied.In the present study,we examined clinical significance of Rab11 in bladder cancer using immunohistochemistry.We also overexpressed and downregulated Rab11expression in bladder cancer cell lines and examined its effect on cell proliferation,invasion,cell cycle progression and apoptosis.We also investigated the molecular signaling pathways underlying the biological effect of Rab11.Methods1.Clinical specimensThe protocol of present study was approved by the reviewer board of China medical university.Clinical tissues were collected from 159 patients who were diagnosed with bladder cancer in the Affiliated First Hospital and Shengjing Hospital of China Medical University since 2010 to 2014.The histological diagnosis and tumor grade were evaluated by pathologist according to the WHO classification guidelines.Tumors were classified into Ta,T1,T2,T3,T4 according to WHO guidelines.2.ImmunohistochemistryTumor specimens were fixed with 10%neutral formalin,and 4μm thick paraffin sections were made.Immunostaining was performed using the S-P staining kit from Maixin(Ultrasensitive^TM,MaiXin,Fuzhou,China).After antigen retrieval in citrate buffer（pH 6.0）for 4 min in an autoclave.0.3%hydrogen peroxide was used for 15minutes and then the sections were incubated with goat serum.Then sections were incubated with Rab11 rabbit polyclonal antibody at 4°C overnight（1:300 dilution,Proteintech,USA）.Secondary antibody incubation was performed at room temperature for two hours.Biotinylated goat anti-rabbit serum IgG was incubated after washing in PBS.Then HRP conjugated streptavidin–biotin was incubated with sections.DAB kit（MaiXin,Fuzhou,China）was used for staining.Counterstaining with hematoxylin was performed and the sections were dehydrated in ethanol before mounting.Two independent pathologists examined all slides randomly.Five views were examined per slide.Immunostaining of Rab11 was scored on a semiquantitative scale by evaluating the intensity and percentage of cells showing positive staining.Cytoplasmic and membrane staining was considered as positive immunostaining.The intensity of Rab11 cytoplasmic staining was also scored as 0（none）,1（weak）,2（marked）.Percentage scores were assigned as 1:1–25%,2:26–50%3:51–75%and 4:76-100%.The scores were multiplied to give a final score of 0 to 8 and the total expression of Rab11 was determined as either negative/weak expression:score<4 or overexpression:score≥4.3.Cell culture and transfectionRT4,BIU-87,5637,T24 cell lines were purchased from ATCC（Manassas,VA,USA）,which were cultured in 1640 medium（Invitrogen,USA）with 10%FBS（Invitrogen）.Cells were passaged every two days with trypsin.For siRNA knockdown,DharmaFECT1 was employed（Dharmacon,CO,USA）.The ONTARGETplus siRNA for Rab11 was also obtained from Dharmacon（Dharmacon,CO,USA）.NonTargeting siRNAa were used as negative control.pCMV6-Rab11 plasmid was obtained from Origene company（Origene,Rockville,USA）.Attractene Transfection was used for transfection of plasmid（Qiagen,Hilden,Germany）.pCMV6 was used as control.BAY 11-7082（Sigma,USA）was used as NF-κB inhibitor.Cell was treated with2μM cisplatin for 24-48 hours.4.Western blot analysisTotal protein was extracted using Pierce lysis buffer（Pierce,Rockford,IL）.Protein quantification was performed using the Bradford method.50μg sample protein was added to SDS-PAGE,which was transferred to PVDF membranes（Millipore,MA,USA）.Incubation of primary antibodies was performed overnight at 4°C.Antibody dilution was listed as follows:Rab11（1:800,Proteintech,USA）,p-IκB,cyclin D1,cyclin E,MMP9,Bcl-2（1:1000;Cell signaling,Boston,MA,USA）,mouse monoclonal antibody againstβ-actin（1:2000;Santa Cruz）.After incubation with HRP-coupled anti-mouse or rabbit IgG antibody（1:1000 dilution,Cell Signaling Technology,USA）at 37°C for 2 hours.Target proteins on PVDF membrane were visualized using Pierce ECL kit and captured using a DNR BioImaging System（DNR,Jerusalem,Israel）.5.Quantitative real-time PCRQuantitative Real-time PCR was performed using SYBR Green master mix kit from Applied Biosystems.PCR was performed using 7500 Real-Time PCR System（Applied Biosystems）β-actin was used as the endogenous control.The relative levels of gene expression were represented asΔCt=Ct gene-Ct reference,and the fold change of gene expression was calculated by the 2^-ΔΔCt Method.Experiments were repeated in triplicate.The primer sequences are as follows:cyclin D forward,5’-TGGAGGTCTGCGAGGAACA-3’;cyclin D reverse,5’-TTCATCTTAGAGGCCACGAACAT-3’;cyclin E forward,5’-AGCCAGCCTTGGGACAATAAT-3’;cyclin E reverse,5’-GAGCCTCTGGATGGTGCAAT-3’;MMP9 forward,5’-CCTCTGGAGGTTCGACGTGA-3’;MMP9 reverse,5’-TAGGCTTTCTCTCGGTACTGGAA-3’;β-actin forward,5’ATAGCACAGCCTGGATAGCAACGTAC 3’;β-actin reverse,5’CACCTTCTACAATGAGCTGCGTGTG 3’.6.CCK-8 Cell proliferation testCell proliferation speed and survival rate were analyzed using Cell Counting Kit-8（CCK-8）kit（Dojindo,Gaithersburg,MD）according to the manufacturer’s protocol.Briefly,Forty-eight hours after transient plasmid or siRNA transfection,cells were seeded about 6×10³ in 96-well plates.Each day the cells were treated with 10μl CCK-8solution for 4 hours.After that,the wells were measured at 490 nm using a microplate reader.7.Reporter assayNF-κB reporter plasmid was purchased form Beyotime（Beyotime Biotechnology,China）（0.2μg）and Renilla luciferase reporter plasmid was obtained from Promega（Promega,USA）.Both plasmids were transfected into bladder cancer cells using Attractene reagent（Qiagen,Germany）.About 30 hours after transfection,dual luciferase reporter kit（Promega,USA）was added to cells and luciferase activity was examined.8.Cell Cycle AnalysisCell cycle analysis:48 hours after transfection,cells were harvested and fixed using1%paraformaldehyde.Then cells were washed with PBS and stained in 5 mg/ml propidium iodide for 30 minutes at room temperature.Flow cytometry was performed using BD FACS Calibur flow cytometer systems（Becton Dickinson,USA）.9.Cell invasion assayMatrigel cell invasion assay was performed using a 24-well transwell chamber（Corning,MA,USA）.The transwell chambers were coated with 20μl matrigel（1:4,BD Bioscience,CA,USA）.Transfected cells were trypsinized and suspended in 100μl of medium without serum,which was transferred to the upper chamber.600μl culture medium with 10%FBS was added to the lower chamber.After 16 hours incubation,the non-invaded cells on the upper membrane surface were removed and the cells that passed through the filter were fixed and stained with hematoxylin.The numbers of cells that pass through the membrane were counted in using microscope.This experiment was performed in triplicate.10.Detection of Apoptosis via FITC-Annexin V/PI StainingAfter 48 hours transfection or depletion,cells were collected and resuspended in 100μL 1 X Annexin V Binding Buffer.5μL FITC-Annexin V were added as well as 5μL PI staining to a final concentration of 5μg/mL and the cells were incubated at room temperature for 15 min in the dark.Then,400μL of Annexin V binding buffer were added and flow cytometry was performed using a BD FACS Calibur flow cytometer.Three independent experiments were performed.11.Statistical analysisSPSS software was used statistical analyses.c2 test was used to examine the clinicopathologic data.t-test was used to compare densitometry data.p<0.05 was considered to indicate statistical significance.Results1.Detection of Rab11 expression pattern in human primary bladder cancer tissues and analysis of the correlation between Rab11 and clinicopathological featuresA panel of 159 primary bladder cancer samples was analyzed by immunohistochemistry.We observed overexpression of Rab11 in 66 out of 159 bladder cancer tissues and the results showed that Rab11 overexpression correlated with local invasion status（Ta-T1 vs T2-T4,p=0.004）.2.The biological roles of up-regulating or down-regulating Rab11 on cell proliferation were detected in human primary bladder cancerIn order to investigate its biological function,we employed Rab11 specific siRNAs in T24 cell line and Rab11 plasmid in BIU-87 cell line.The results showed that Rab11transfection promoted cell growth rate and its depletion inhibited cell proliferation。3.The biological roles of up-regulating or down-regulating Rab11 on cell cycle were detected in human primary bladder cancerCell cycle analysis was also performed and we found that G1 phase percentage was downregulated and S phase percentage was upregulated after Rab11 transfection.In addition,Rab11 overexpression increased cyclin D1 and cyclin E levels.Meanwhile,Rab11 depletion decreased the percentage of S phase cells and increased the percentage of G1 phase cells.Additionally,Rab11 overexpression decreased cyclin D1 and cyclin E levels.The above results indicate that Rab11 regulates cell cycle related proteins and facilitates cell cycle progression.4.The biological roles of up-regulating or down-regulating Rab11 on cell invasion were detected in human primary bladder cancerWe performed Matrigel invasion assay to examine the role of Rab11 on the invading ability in bladder cancer cell lines.The results showed Rab11 overexpression facilitated cell invasion while its depletion inhibited cell invasion.Rab11 overexpression upregulated while its depletion downregulated MMP9 level,which was closely related to invasion control.5.The biological roles of up-regulating or down-regulating Rab11 on the activity of NF-κB pathway were detected in human primary bladder cancerUsing luciferase reporter assay,we showed that Rab11 transfection increased the level of NF-κB reporter activity and p-IκB expression.On the contrary,Rab11 depletion decreased the level of NF-κB reporter activity and p-IκB expression.We also found that NF-κB inhibitor blocked the Rab11 induced expression of cyclin D1 and MMP9.6.The biological roles of up-regulating or down-regulating Rab11 on cell survival and apoptosis after cisplatin treatment were detected in human primary bladder cancerWe also investigated the effect of Rab11 depletion on cell apoptosis after 2μm cisplatin treatment.We found that Rab11 knockdown could decrease cell survival and and increase cell apoptosis.Rab11 overexpression could increase cell survival and and decrease cell apoptosis.7.In order to investigate the mechanism underlying bladder cancer cell apoptosis affected by Rab11,the effect of Rab11 on cell apoptosis related molecule Bcl-2 was examined.We examined the effect of Rab11 on Bcl-2 expression.Western blotting analysis revealed that Rab11 depletion could decrease the level of Bcl-2 while Rab11overexpression could increase the expression of Bcl-2.Conclusion:1.Rab11 was overexpressed in primary bladder cancer tissues（66/159）.Significant association was observed between Rab11 overexpression and invading depth（p=0.004）.2.Rab11 promoted cell proliferation and invasion in primary bladder cancer.3.Rab11 upregulated the mRNA and protein levles of cyclinD1,cyclin E and MMP9 in primary bladder cancer.4.Rab11 enhanced NF-κB activity to modulate the expression of cyclinD1 and MMP9 in primary bladder cancer.5.Rab11 could increase cell survival and and decrease cell apoptosis in primary bladder cancer.6.Rab11 could increase the level of Bcl-2 in primary bladder cancer.