Effects Of Sp1 In Vascular Calcification And The Underlying Mechanisms Exploration

BackgroundVascular calcification is an important link between cardiovascular diseases and end-stage renal disease,aging and diabetes and is a major risk factor for cardiovascular mortality and a predictor of mortality in patients with end-stage renal disease and diabetes.Recent studies have shown that phosphate(Pi)levels are key in vascular calcification in terms of both clinical trials and experimental models.Vascular calcification is a process of active cell regulation rather than pure passive calcium deposition.Potential mechanisms of vascular smooth muscle cells(VSMCs)calcification are involved in apoptosis,matrix vesicle(MV)release,conversion of the phenotype of vascular smooth muscle cells into osteoblast-like cells characterized by the a loss of contractile markers of VSMCs,such as α-smooth muscle actin(α-sma),calponin,and smooth muscle 22a(sm 22α),and expressing osteogenic-profile markers,including runt related transcription factor 2(Runx2),alkaline phosphatase(ALP),osteopontin,osteocalcin,bone morphogenetic protein 2,and osterix,and vascular remodeling.Apoptosis and the products of apoptosis degradation-matrix vesicles are considered as a starting point or initiating link of vascular calcification.Specificity protein 1(Spl)is a transactivation molecule that is a founding member of the Sp/KLF family of transcription factors.Previous studies have shown that there are Spl binding sites in human genome,which explains the role of Spl as an activator or suppressor,including cell growth,differentiation,apoptosis,chromatin remodeling,fibrosis,inflammation and DNA damage.BMP2,an osteogenic-profile marker,is the target gene for Spl in BMP2-expressing F9 cell model system.Growing evidence suggested that the potential mechanisms mediating calcification of vascular smooth muscle cells include osteogenic/chondrogenic conversion,apoptosis,matrix vesicle(MV)release,and matrix remodeling.Woeckel,et al.reported that 1,25(OH)2D3 acted in the early phase of osteoblast differentiation to stimulate mineralization by increasing MV production.Furthermore,numerous studies confirmed that the tunica media apoptotic degradation product matrix vesicles were the initiating link of vascular calcification,which demonstrated matrix vesicles played a pivotal role in the pathophysiological process of calcification.Metformin,one of the mostly widely used antidiabetic drugs,activates AMPK in vivo and is recommended by the American Diabetes Association for newly diagnosed type 2 diabetic patients because of its hypoglycemic effects and ability to reduce cardiovascular morbidity and mortality.Recently,in vivo and in vitro studies suggested a protective action of metformin against several cardiovascular diseases linked.to T2D,including myocardial infarction,hypertrophy,and diabetic cardiomyopathy.Multiple molecular mechanisms were proposed,including reduction of ER stress,oxidative stress,apoptosis,and protein synthesis,as well as insulin resistance in endothelial cells,cardiomyocytes,and cardiac fibroblasts via AMPK-dependent and AMPK-independent pathways.In a clinical study,insulin treatment was associated with a significant reduction in osteoprotegerin(OPG)levels and,despite not achieving full statistical significance,there was a trend towards increased coronary artery calcification(CAC)in patients.However,metformin,as insulin sensitization agent,does not increase insulin secretion.Additionally,inspection of published results for metformin shows that like metformin,knockdown of Spl,Sp3 and Sp4 also inhibits cancer cell growth and migration and induces apoptosis.Meanwhile,metformin also decreases expression of several Sp-regulated genes in cancer cells.The effects of metformin on expression of several Sp-regulated genes suggest that SpI,Sp3 and Sp4 may be targets of metformin.Given that the above function of Spl is highly correlated with the pathology of vascular calcification,we hypothesized that Spl may be involved in the regulation of vascular calcification and may be a target of metformin.To test this hypothesis,we used in vitro and in vivo experimental models to mimic the internal environment of patients with vascular calcification.This study includes four parts:Part I Effects of Spl on phenotype switching of vascular smooth muscle cellsin Vascular Calcification;Part II Effects of Spl on VSMCs Apoptosis in Vascular Calcification;Part III Effects of Metformin on Vascular Calcification and the Underlying Mechanisms.Part I Effects of Spl on phenotype switching of vascular smooth muscle cells in Vascular CalcificationObjective1.To investigate whether the expression of Sp1 changes in vascular calcification;2.To detect the regulation of calcium deposit and ALP activity by Spl in vivo and in vitro;3.To investigate the effect of Spl on phenotype switching of vascular smooth muscle cells in vivo and in vitro;4.To illustrate the possible molecular mechanism involved in the effect of Spl on phenotype switching of vascular smooth muscle cells.Methods1.Patients and sample processingTo detect the Sp1 expression in calcified human aorta,the discarded aortic tissue is collected from patients(n=4)undergoing coronary artery bypass graft(CABG)surgery with or without aortic calcification.2.Animal model and Gene silencing of SplWistar rats were housed under standard conditions.5×1010 plaque-forming units of either adenovirus harbouring Sp1 knockdown gene(Ad-Spl)or empty virus(vehicle)was delivered into the rats via the jugular vein injection.Adenovirus transfer repeated in 2weeks.After a 3-day recovery period of the first adenovirus injection,vascular calcification was induced with vitamin D3 and administered nicotine dissolved in in peanut oil.3.Cell culture and treatmentsA7r5 cells were used in the experiments.For calcification,confluent VSMCs were incubated in DMEM containing 10%FBS and 10 mM β-glycerophosphate(β-GP,Sigma-Aldrich)for 2-14 days.Sp1 gene silencing was achieved by infecting the cells with adenovirus harbouring Sp1 knockdown gene(Ad-Spl).The cells in Spl inhibition group were treated with Sp1 inhibitor mithramycin(MTM,Cayman Chemical)before inducing calcification.4.Laser scanning confocal microscope detectionThe expression of BMP2 and a-SMA in vascular smooth muscle cells was detected by cell immunofluorescence assay5.Calcification stainingTo visualize calcium deposition,the sections of aortas and VSMCs were stained with 1 mg/ml Alizarin red solution(pH 4.2).6.Immunohistochemical stainingThe specimens were collected and paraffin sections were prepared.After conventional dewaxing,anti-sp1 antibody was used for immunohistochemical staining.7.Quantification of calcium deposition and ALP activityCalcium content was determined using the QuantiChrom Calcium Assay Kit according to the manufacturer’s instructions and was normalized to the protein content.The ALP activity was measured using an ALP assay kit and the results were normalized to the total protein concentration.8.Western blot analysisProteins were isolated from vascular tissue.Primary antibodies against Spl(0.1 μg/ml,Millipore),P-actin(1:1000 dilution),GAPDH(1:1000 dilution)and horseradish peroxidase-conjugated secondary antibody were used.9.Real time PCR analysisRNA was extracted from vascular tissue and the mRNA expression level of Spl was analyzed by RT-PCR.10.Quantitative real time PCR(RT-qPCR)analysisRNA was extracted from treated VSMCs and the mRNA expression levels of BMP2、Runx2、α-SMA and Calponin were analyzed by RT-qPCR.The relative mRNA expression between treatments was analyzed by 2-△△CT method.Targeted gene expression was normalized against GAPDH expression.11.Luciferase assaysConstructs BMP2-LUC(full length)and B271-LUC(nt-241 to 30)was created by digesting the resulting plasmid with KpnI and subcloning into the luciferase reporter vector,GV354(Genechem,Shanghai)cut with KpnI.Constructs were transfected into MOVAs cells before treated with β-GP.Firefly and renilla luciferase were measured using the Dual-Luciferase reporter assay system(Promega)according to the manufacturer’s instructions.12.Chromatin immunoprecipitation assay(ChIP)Nucleoprotein complexes were prepared from MOVAs cells treated with or withoutβ-GP.ChIP was performed using SimpleChIP(?)Plus Enzymatic Chromatin IP Kit(Cell Signaling Technology)according to the manufacturer’s instructions.An anti-Spl antibody(Millipore)was used.The primers used for PCR were as follows:BMP2 promoter:forward:5’ TCACACTCATCCGGGACGC 3’,and reverse:5’GAACACCTCCCCCTCGGA 3’.13.Electrophoretic mobility shift assay(EMSA)Nuclear extracts were prepared by using NE-PER Nuclear and Cytoplasmic Extract kit(PIERCE).EMSA was performed using LightShift Chemiluminescent EMSA Kit(PIERCE)according to the manufacturer’s specifications.The sequences of the probes were as follows:sense:5’ GCGCTCGCCCCGCCCCGCTCCACC 3’;antisense:5’GGTGGAGCGGGGCGGGGCGAGCGC 3’.14.Statistical analysisData are reported as the mean±SEM.For two-group comparisons of parametric data,a Student t-test was performed,whereas nonparametric data were analyzed with Mann-Whitney test.Statistical significance between multiple groups was determined by one-way ANOVA followed by Tukey’s multiple comparisons test(parametric),Kruskal-Wallis test followed by Dunn’s multiple comparisons test(nonparametric),where appropriate,p<0.05 was considered statistically significant.All statistical analyses involved use of SPSS v20.0(SPSS Inc.,Chicago,IL).Results1.Elevated Spl expression in both human and rat calcified aorta;2.Spl expression was significantly suppressed by Ad-Spl in comparison with the vehicle group;3.Either Spl gene silencing or Spl inhi’bition protected VSMCs from calcium deposition;4.Compared with the vehicle group,ALP activity was ameliorated by the treatment of Either Sp1 gene silencing or Sp1 inhibition;5.Sp1 gene silencing or Sp1 inhibition suppressed expression of the osteogenic markers and reserved expression of the contractile phenotype markers;6.The luciferase activity of both full length BMP2 promoter and part of BMP2 promoter containing Sp1-binding element were elevated byβ-GP treated as demonstrated by luciferase assay;7.The BMP2 promoter is the direct target of Sp1 in VSMCs,and β-GP increased Sp1 DNA binding activity with BMP2 promoter.Conclusion1.Elevated Sp1 expression in both human and rat calcified aorta;2.Sp1 gene silencing attenuates the vascular calcification observed in VDN in vivo and in vitro.In the meantime,mithramycin,a Sp1 inhibitor,prevents calcification observed in the P-GP treated VSMCs.Therefore,Sp1 is likely to be a potential target for the prevention or treatment of vascular calcification;3.Sp1 gene silencing or Sp1 inhibition suppressed phenotype switching of vascular smooth muscle cells;4.The BMP2 promoter is the direct target of Sp1 in VSMCs,and β-GP increased Sp1 DNA binding activity with BMP2 promoter.Sp1 plays an important role in vascular calcification.Part Ⅱ Effects of Sp1 on VSMCs Apoptosis in Vascular CalcificationObjective1.To study the effect of Sp1 on VSMCs apoptosis in vivo and in vitro;2.To explore the potential molecular mechanism of Sp1 on VSMCs apoptosis.Methods1.Animal model and Gene silencing of Sp1Wistar rats were housed under standard conditions.5×1010 plaque-forming units of either adenovirus harbouring Sp1 knockdown gene(Ad-Sp1)or empty virus(vehicle)was delivered into the rats via the jugular vein injection.Adenovirus transfer repeated in 2weeks.After a 3-day recovery period of the first adenovirus injection,vascular calcification was induced with vitamin D3 and administered nicotine dissolved in in peanut oil.2.Cell culture and treatmentsA7r5 cells were used in the experiments.For calcification,confluent VSMCs were incubated in DMEM containing 10%FBS and 10 mM β-glycerophosphate(β-GP,Sigma-Aldrich)for 2-14 days.Sp1 gene silencing was achieved by infecting the cells with adenovirus harbouring Sp1 knockdown gene(Ad-Sp1).The cells in Sp1 inhibition group were treated with Sp1 inhibitor mithramycin(MTM,Cayman Chemical)before inducing calcification.3.Detection of VSMCs apoptosisApoptosis was assessed using the In Situ Cell Death Detection Kit and Annexin V/propidium iodide(PI)double staining kit according to the manufacturer’s specifications.4.Western blot analysisProteins were isolated from vascular tissue.Primary antibodies against caspase 3,p53,β-actin,GAPDH and horseradish peroxidase-conjugated secondary antibody were used.5.Caspase 3 activity assayCaspase-3 activity was assessed using caspase-3 colorimetric assay kits according to the manufacturer’s specifications,measured from the absorbance at 400 nm using a microplate reader.6.Quantification of MVsA7r5 cells were treated and the medium was collected and digested by collagenase.MVs were isolated from the supernatant after centrifugation at 100000g for 30min at 4℃.MVs were then resuspended in 1%Triton X-100,and protein content were determined by using BCA protein assay kits.An increase in protein content indicated an increased number of MVs.7.Statistical analysisData are reported as the mean±SEM.For two-group comparisons of parametric data,a Student t-test was performed,whereas nonparametric data were analyzed with Mann-Whitney test.Statistical significance between multiple groups was determined by one-way ANOVA followed by Tukey’s multiple comparisons test(parametric),Kruskal-Wallis test followed by Dunn’s multiple comparisons test(nonparametric),where appropriate,p<0.05 was considered statistically significant.All statistical analyses involved use of SPSS v20.0.Results1.Either Sp1 gene silencing or Sp1 inhibition suppressed apoptosis as well as matrix vesicles release;2.Compared to the vehicle group,elevated expression levels of cleaved-caspase 3 and p53 were decreased in the Sp1 gene-silencing group as well as in the mithramycin group;3.Ad-Sp1 or mithramycin treatment significantly inhibited caspase 3 activity.Conclusion1.1 Either Sp1 gene silencing or Sp1 inhibition suppressed apoptosis as well as matrix vesicles release;2.To increase apoptosis as well as matrix vesicles release may be the mechanism of Spl on vascular calcification;3.Increasing apoptosis as well as matrix vesicles release may be due to activation of caspase 3 and elevated p53.Part Ⅲ Effects of Metformin on Vascular Calcification and the Underlying MechanismsObjective1.To establish animal models of vascular calcification in rat induced by vitamin D3 and nicotine,and detect the effect of metformin on vascular calcification;2.To explore the possible mechanism of metformin on vascular calcification;3.Mechanisms of action of metformin:is Sp1 a target?Methods1.Animal modelWistar rats were housed under standard conditions.Vascular calcification was induced with vitamin D3 and administered nicotine dissolved in in peanut oil.2.Calcification stainingTo visualize calcium deposition,the sections of aortas were stained with 1 mg/ml Alizarin red solution(pH 8.3).3.Immunohistochemical stainingThe specimens were collected and paraffin sections were prepared.After conventional dewaxing,anti-Collagen Ⅰ and anti-Sp1 antibodies were used for immunohistochemical staining.4.Quantification of calcium deposition and ALP activityCalcium content was determined using the QuantiChrom Calcium Assay Kit according to the manufacturer’s instructions and was normalized to the protein content.The ALP activity was measured using an ALP assay kit and the results were normalized to the total protein concentration.5.Western blot analysisProteins were isolated from vascular tissue.Primary antibodies and horseradish peroxidase-conjugated secondary antibody were used.6.Detection of apoptosisApoptosis was assessed using the In Situ Cell Death Detection Kit according to the manufacturer’s specifications.7.Measurement of blood pressure,heart rate,body weight,and echocardiographyHeart rate(HR),systolic blood pressure(SBP)and diastolic blood pressure(DBP)were measured with a noninvasive tail-cuff system.Echocardiography was performed using the Vevo2100 imaging system.Images were obtained from the two-dimensional and M-mode.Wall thickness and LV dimensions were obtained from a long-axis view at the level of chordae tendineae.Diameters of the left ventricular end diastole,left ventricular end-diastolic posterior wall,and septum thickness were measured according to the American Society of Echocardiography guidelines.8.Statistical analysisData are reported as the mean ± SD.First,we use the homogeneity of variance test and Kolmogorov-Smirmov test.Second,multiple groups were performed by one-way ANOVA followed by post-hoc individual comparisons.Third,if the variance is homogeneous,we use LSD test to compare the mean of each group with the mean of every other column;if the variance is not homogeneous,we use Dunnett’s T3 test to obtain P-value.Differences were considered statistically significant at P b 0.05.All statistical analyses involved use of SPSS v20.0.Results1.Characteristics of the rats at the end of experimentAt baseline,the blood pressure,body weight,and cardiac structure were not different among these three groups.The SBP and DBP were significantly decreased after metformin treatment.Echocardiography showed that the LVIDd and LVIDs in the VDN group were significantly decreased compared to the control group.The LVPWd and LVmass/BW were significantly increased compared to the control group,suggesting that hypertrophy of the left ventricle occurred in this vascular calcification model.After treatment with by metformin,the LVIDd and LVIDs were up-regulated and the LVPWd and LVmass/BW were recovered,suggesting that metformin maintained the normal cardiac structure and reversed the ventricular remodeling.2.Metformin effectively inhibits vascular calcification induced by VDN;3.Metformin prevents vascular smooth muscle cell transdifferentiation into osteoblast-like cells;4.Metformin alleviates elastin degradation and collagen accumulation;5.Metformin suppresses tunica media apoptosis;6.The AMPK phosphorylation in the metformin-treated group was up-regulated compared to the VDN group.Simultaneously,the expression level of phospho-eNOS was up-regulated and the levels of TGF-β1 and phospho-Smad2/3 were down-regulated;7.Sp1 expression and binding activity was suppressed by metformin treatment.Conclusion1.Metformin effectively inhibits vascular calcification2.The mechanism of metformin on vascular calcification may be to prevent vascular smooth muscle cell transdifferentiation into osteoblast-like cells,to alleviate elastin degradation and collagen accumulation and to suppress tunica media apoptosis;3.Metformin prevents vascular calcification via AMPK-eNOS/TGF-β pathway;4.Sp1 may be a target of metformin.