The Study Of Pathogenic Gene In Familial Adenomatous Polyposis Of Yunnan Province And The Mechanism Research Of Synonymous Mutation SNP In APC Gene

Objectives:To collect familial adenomatous polyposis（FAP）pedigrees from different geographical areas and ethnic minorities and establish hereditary colorectal cancer specimen’s library in Yunnan Province.On the basis of arranging samples of FAP patients,by investigating the molecular change detection of the key signal elememts in the Wnt/beta-catenin pathway,and through multi gene screening and bioinformatics prediction,we study the pathogenic gene mutation site of FAP.For synonymous variant predicted to be disease causing in FAP,hybrid mini-gene assay was further used to confirm the exon skipping impact.Methods:1.Tissue samples were collected from FAP probandsof the Yunnan province,and pedigree information was aslo collected,and further enrich hereditary colorectal cancer specimen’s library.2.20 samples from our hereditary colorectal cancer specimen’s library were randomized to our study.DNA of all samples were extracted and multiple gene screening of APC,MYH and AXIN2 gene were conduceted,and then the pathogenic germline mutations were further studied by bioinformatics prediction.3.For APC mutation negative patients,choose one of the minority（BAI）of of whole genome sequencing was apllied to detect single nucleotide variation,copy number variation and structure variation for all 7 family members in a BAI FAP pedigree.4.For synonymous variant predicted to be disease causing（synonymous SNP c.1458?>C——locating at the edge of 12 exon in APC）,hybrid mini-gene assay and exon skipping assay were further used to confirm the exon skipping impact.Results:1.Through the investigation and further consolidation of outpatient and inpatient medical records,31 typical FAP pedigrees were collected,among ethnic groups,there are 3 Bai,1 Yi,1 Muslim,19 Han,and 7 mixed families.2.By whole-gene sequencing of APC gene,3 pathogenic mutations were found,one is nonsense mutation c.3587C>A（p.S1196X）,and the other 2 pathogenic mutations are heterozygous mutation repeat c.1959-143₁959-140het_dupAGAA and loss of heterozygosity c.6123₆124het_delAT.For MYH gene screening,2 nonsense mutations（c.456T>A p.Y152X and c.1564T>G p.G522 X）and 2 heterozygous deletions（c.143 5-106₁43 5-63het_delGCCTAGCTAGATCAGTAGAGTCGGGGAAAGG GAGAGAGGACAAG and c.1566+33₁566+35het_delTGT）were detected.For AXIN2 gene screening,4 synonymous mutations were found,among those synonymous mutations,synonymous substitution c.2062C>T（p.L688L）was previously proved to be a pathogenic mutation.3.Whole genome sequencing analysis revealed that the structure variation of DCC gene is the main reason for the family members of BAI FAP;7 SNV（OR5AN1,OR5A1,LOXL,CEACAM21,C20orf201,ABCB5,PAPR15）and 3 indel SNV（CELA1,C18orf25 and MAGI）might be correlated with the occurrence and development of FAP.4.By hybrid mini-gene assay,wild type（wt）and mutant type（mt）mini-gene constructs of synonymous SNP c.1458T>C were artificially synthesized.then recombined plasmids pEGFP-N 1-wt-mini-gene and pEGFP-N 1-mt-mini-gene were constructed respectively.The wild and mutant mini-gene constructs were transiently transfected into HeLa cells,and Total RNA was extracted and analyzed by RT-PCR.RT-PCR products were separated by electrophoresis.And the final results indicated that synonymous SNP c.1458T>C induce a major splicing defect with skipping of exon 12 in APC.Conclusions:1.Collection and preservation of FAP families in Yunnan province not only improve the application value of the specimens,but also save the genetic resources.Studies based on our hereditary colorectal cancer specimen’s library will help to find new mutations of FAP related genes.2.After multi-gene screening of APC,MYH and AXIN2 gene of 20 different FAP probands in our cohort,8 different pathogenic mutations in 8 FAP individuals were found,the detection rate is 40%in Yunnan province.3.Whole genome sequencing analysis reveales that the structure variation of DCC gene is the main cause of FAP FAP Bai family,suggesting that the DCC gene is a candidate gene for FAP.4.Synonymous substitution c.1458T>C is confirmed to lead to APC protein truncating.However,further ESE dependent experiments are needed to investigate the mechanism of exon skipping.