The Role And Mechanism Of FOXO3a/FOXM1 In HTERT-promoted Invasion And Metastasis Of Gastric Cancer Cells

BackgroundMetastasis is the most common cause of human cancer death, and the underlying mechanism remains elusive. Telomerase is a ribonuclease with reverse transcriptase activity, which can synthesize telomeric repeat sequences according to the template RNA. The telomeric repeat sequences are added to the ends of chromosomes to maintain the integrity of the chromosomal structure. Human telomerase reverse transcriptase(h TERT), which represents the telomerase activity, is low or even hardly expressed in normal cells, so most normal human somatic cells are lack of telomerase activity. The telomeres will be shortened as the mitosis happens. Once the telomeres are shortened to a certain extent, the aging cells die. However, high expression of h TERT and activation of telomerase were observed in more than 90% of human cancers. As a result of the telomerase activation in tumor cells, although the telomere is shorten after cell division, telomerase would synthesize new telomere repeats and add them to the ends of chromosomes, thereby maintaining the length of telomere in tumor cells and keep them immortalized. Once telomerase activity or expression of h TERT is inhibited, the telomeres of cancer cells will be gradually shortened, leading to cell senescence or apoptosis and the eventual loss of tumorigenicity. Telomerase activation or h TERT gene is highly expressed in most cancers and they are closely related to disease progression and poor prognosis.Previous studies mainly focused on the role of telomerase in maintaining telomere stability and promoting the growth of tumor cells. During recent years, accumulating evidence showed that h TERT can also promote tumor invasion and metastasis. Meta-analysis by our group revealed that telomerase activation and expression of h TERT is closely associated with the invasion and metastasis of gastric cancer cells, but the underlying mechanisms are still unclear. Therefore, understanding of the mechanisms of h TERT-induced invasion and metastasis of gastric cancer cells could provide novel strategy for the prevention of invasion and metastasis of tumors.Objective: This study aims to investigate the role and the mechanisms of h TERT in the invasion of cancer, taking the gastric cancer as the model.Methods and Materials:(1) Proteomics were used to compare the different expression of proteins between the h TERT-overexpressed and corresponding control group in U2 OS cells.(2) Quantitative PCR and Western blot(WB) were applied to test the candidates involved in the invasion those were up-regulated more than 5 times by h TERT and ITGB1 was screened out as the h TERT-downstream gene.(3) Ch IP-q PCR was employed to identify the possible binding region of h TERT during the 27 kb histone-modification region of ITGB1 gene.(4) Dual luciferase reporter assays were used to further shorten the response area of h TERT.(5) Bioinformatics and Chromatin Immunoprecipitation(Ch IP) assays proved that two transcription factors(FOXM1 and FOXO3a) directly bound to the h TERT-regulated regions of ITGB1 gene.(6) Cell adhesion and invasion assays were applied to test the influence of FOXM1 and FOXO3 a on cell adhesion and invasion of gastric cancer cells.(7) After construction of different combinations of dual luciferase reporter plasmids, FOXO3 a was proved to play a major role in the h TERT-mediated up-regulation of ITGB1; Electrophoretic Mobility Shift Assay(EMSA) resolved the specific binding sites of FOXO3 a during ITGB1 gene.(8) Double immunofluorescence revealed the cellular localization of h TERT and FOXO3 a and co-immunoprecipitation tested the interaction between h TERT and FOXO3 a.(9) q PCR and Western blot analyzed the effect of m RNA and protein of FOXO3 a after h TERT overexpression.(10) Co-immunoprecipitation detected the ubiquitination-mediated degradation of FOXO3 a by h TERT overexpression.(11) After analysis of the previously-reported E3 ubiquitin ligase those are responsible for the degradation of FOXO3 a, double immunofluorescence tested the co-localization of h TERT and the E3 ligase and co-immunoprecipitation analyzed the protein-protein interaction between h TERT and the E3 ligase. Ubiquitination of FOXO3 a mediated by h TERT was also detected after interference of the E3 ligase.(12) The effect of h TERT on the invasion of gastric cancer cells was detected in the gastric cancer metastasis model in nude mice. The above certificated pathway was further tested in vivo.(13) Immunohistochemistry was used to assay the expression level of h TERT, FOXO3 a and ITGB1 in the clinical gastric cancer tissues, and the associations between them were also analyzed. The correlation between their expression and clinicpathological features and prognosis of gastric cancer patients were further analyzed.Results:(1) Proteomics revealed that compared to the control group, ten candidates involved in tumor invasion and metastasis were up-regulated more than five times after h TERT overexpression in U2OS(h TERT negative) cells. The candidates are: NDRG1, ITGB1, PRAF2, SIRT1, SA100A9, ATOX1, CD97, KDR, VASP, SMURF1.(2) q PCR confirmed that the m RNA of ITGB1, PRAF2, CD97 were up-regulated after overexpression of h TERT in three tumor cells(U2OS osteosarcoma, SGC-7901 gastric cancer cells and HGC-27 cells). Western blot confirmed that only the protein of ITGB1 was significantly upregulated in the above three cells. Interference ITGB1 partially inhibited the h TERT- mediated adhesion and metastasis of tumor cells.(3) Ch IP-q PCR initially revealed that h TERT could bind to two regions of the histone modification region of ITGB1(26644bp)(one was located in the promoter region, and another in the 1st intron region).(4) After construction of 12 luciferase reporter plasmids(six are in the intron 1, named p GL3-I1~I6; the other six are in the promoter region, named p GL3-P1~P6). Dual luciferase reporter assays confirmed that h TERT modulated the activity of p GL3-I5 and p GL3-P5.(5) Bioinformatics predicted that there are six potential transcription factors binding sites during the p GL3-I5 region(+ 9913 + 10010): c-Rel, EST-1, SP1, FOXO3 a, FOXP3, HNF-3b; There are five possible transcription factors binding sites during the p GL3-P5(-1166,-1074): c-Rel, EST-1, HNF-3b, FOXM1, FOXP3. Ch IP experiments confirmed that FOXM1 and FOXO3 a can bind to the promoter region of the ITGB1 gene(-1166 ~-1074) and intron 1 region(+ 9913 + 10010), respectively.(6) q PCR and Western blot showed that FOXM1 promoted the m RNA and protein expression of ITGB1, while FOXO3 a significantly inhibited the m RNA and protein expression of ITGB1. Cell adhesion and invasion assay demonstrated FOXM1 promoted while FOXO3 a inhibited adhesion and invasion of gastric cancer cells.(7) After the construction of the recombinant plasmid(p GL3-I5 and p GL3-P5) and corresponding deletion mutant plasmid, dual luciferase reporter assays confirmed that h TERT induced ITGB1 expression mainly via FOXO3 a response element(FOXM1 response elements play a secondary role). Electrophoretic mobility shift assay(EMSA) revealed that FOXO3 a bound to F3BE(CAGAGCATTTGTATTTTGTCTACTA) during the intron 1 region of ITGB1.(8) Immunofluorescence and co-immunoprecipitation experiments demonstrated that h TERT and FOXO3 a were co-localized in the cells, and h TERT and FOXO3 a formed protein-protein complex.(9) q PCR showed that h TERT did not affect the m RNA expression of FOXO3 a, but could inhibit its protein expression.(10)Co-immunoprecipitation confirmed that h TERT promoted ubiquitin-degradation of FOXO3 a.(11)Although bioinformatics predicted that both of MDM2 andβ-TRCP could interact with h TERT, Co-immunoprecipitation experiments confirmed that only MDM2 interacted with h TERT; Double immunofluorescence revealed that h TERT and MDM2 were co-localized in cells; Overexpression of h TERT promoted the interaction between MDM2 and FOXO3a; Silence of MDM2 alleviated h TERT-mediated ubiquitination degradation of FOXO3 a and subsequent adhesion and invasion of gastric cancer cells.(12) h TERT significantly promoted the invasion and metastasis of gastric cancer cells in nude mice. Double immunofluorescence staining and immunohistochemical staining demonstrated that h TERT inhibited the expression of FOXO3 a but promoted the expression of ITGB1.(13) In gastric cancer tissues, the expression of h TERT was negatively associated with the expression of FOXO3 a while h TERT was positively correlated with that of ITGB1. High expression of h TERT or ITGB1 as well as low expression of FOXO3 a predicted poor prognosis of gastric cancer patients. A combination of the above indexes is a better way than a single index to predict the survival time of gastric cancer patients.Conclusion: Taken together, "h TERT/MDM2-FOXO3a-ITGB1" pathway may account for the molecular mechanisms of h TERT-promoted invasion and metastasis of gastric cancer and modulation of this pathway can be used as a novel strategy for prevention of tumor metastasis.Background:In the first part of our experiments, we have clearly demonstrated that both FOXO3 a and FOXM1 were involved in h TERT-mediated ITGB1 up-regulation as well as adhesion, invasion and metastasis of gastric cancer cells, and FOXO3 a plays a more imoportant role than FOXM1.Besides, our previous work has shown that FOXM1 plays an important role in the regulation of cell cycle progression. The specific agonist of liver X receptor GW3965-activated LXR inhibited the expression of FOXM1 and thus suppressed the proliferation of tumor cells(Hu. C, et al Oncogene 2014 29; 33(22):. 2888-97). FOXM1 is one member of the superfamily with conserved DNA binding domain(also known as winged helix DNA-binding domain), and it is highly expressed in tumors. The capacity of tumor meatstasis is positively correlated with the expression of FOXM1. Recent studies revealed that FOXM1 expression levels are closely related to the sensitivity of tumor cells to chemotherapy drugs. Those pancreatic cancer suffers with high FOXM1 expression were relatively insensitive to chemotherapy, and silence of FOXM1 induced apoptosis of tumor cells and sensitized the effect of chemotherapy, suggesting that FOXM1 palys an anti-apoptosis role.However, the detailed mechanism is unclear. In gastric cancer cells, whether FOXM1 could affect the sensitivity of tumor cells to chemotherapeutic drugs is unclear.Oxaliplatin, a third-generation platinum-based chemotherapy drugs, has been widely used as first-line chemotherapy in patients with advanced gastric cancer. However, some patients are not very sensitive to it, the reasons may included abnormal mi RNA expression, H. pylori infection, activated oncogenes, abnormal expression of transcription factors. During these possible mechanisms, overexpression of anti-apoptotic protein is one of the important reasons.Myeloid leukemia factor-1(Mcl-1) belongs to the anti-apoptotic Bcl-2 family. Mcl-1 interacts with pro-apoptotic proteins, including Bim 、 Noxa and Bak, stabilizing the mitochondrial membrane and preventing apoptosis. Mcl-1 can also contribute to ATP production and mitochondrial fusion. As an important anti-apoptotic protein and target for cancer treatment, the research of transcriptional regulation of Mcl-1 is very important. It has been reported that Mcl-1 was highly expressed in gastric cancer patients; silence of Mcl-1 sensitized the gastric cells to chemotherapy drugs. Mcl-1 expression levels are also closely correlated to the prognosis of patients with gastric cancer. Therefore, clarification of the transcriptional regulatory mechanism of Mcl-1 will be beneficial for chemotherapy. Although both of FOXM1 and Mcl-1 are associated with the effect of chemotherapy and prognosis of tumor suffers, in gastric cancer suffers, whether FOXM1 could affect the chemotherapy response and whether FOXM1 regulates Mcl-1 to mediate the anti-apoptosis response of gastric cancer cells to chemotherapy is still unknown.Objective: To investigate the effects of FOXM1 on the sensitivity of gastric cancer cells to oxiliplatin and clarify the relevant mechanism.Methods and Materials(1) Immunohistochemical analysis and Real-time PCR was used to assay the expression of protein and m RNA of FOXM1 and Mcl-1 in human gastric cancer specimens and corresponding adjacent specimens, respectively.(2) Real-time PCR and Western blot was applied to examine Mcl-1 expression after knockdown of FOXM1 in BGC-823 cells(high FOXM1 expression) or overexpression of FOXM1 in MKN45 cells(low FOXM1 expression).(3) The potential FOXM1 binding sites during Mcl-1 gene promoter region was predicted by bioinformatics Subsequently, luciferase reporter assay was employed to analyze the influence of FOXM1 on the transcriptional activity of Mcl-1 gene promoter.(4) Electrophoresis mobility shift assay(EMSA) and T7 TNT quick-coupled transcription/ translation system was also used to assay the interaction between FOXM1 protein and the specific probe derived from 5′ regulatory region of Mcl-1 gene. Moreover, Chromatin Immunoprecipitation(Ch IP) was employed to examine whether FOXM1 could bind to a response element in Mcl-1 gene promoter region.(5) Cell counting kit-8(CCK-8) was used to test the proliferation of gastric cancer cells after alleviation of FOXM1-Mcl-1 pathway in BGC-823 cells or enhancement of FOXM1-Mcl-1pathway in MKN45 cells in the treatment of oxaliplatin.(6) Annexin V–FITC/PI staining and western blot(for cleaved PARP) were applied to assay the apoptosis of BGC-823 cells after alleviation of FOXM1-Mcl-1 pathway and that of MKN45 cells after enhancement of FOXM1-Mcl-1pathway in the treatment of oxaliplatin.Results(1) FOXM1 and Mcl-1 expression levels are positively correlated in human gastric cancer specimens.(2) Both of FOXM1 and Mcl-1 are associated with poor prognosis.(3) Overexpression of FOXM1 upregulates Mcl-1 expression in MKN45 cells, whereas downregulation of it inhibits Mcl-1 expression in BGC-823 cells.(4)Overexpression of FOXM1 increases the transcriptional activity of Mcl-1 gene promoter in MKN45 cells, whereas downregulation of FOXM1 decreases Mcl-1 promoter activity in BGC-823 cells.(5) FOXM1 bound directly to a site(-635acaaacaa-628) during Mcl-1 promoter region. Furthermore, overexpression of FOXM1 could increase the interaction between FOXM1 protein and Mcl-1 promoter region, whereas downregulation of FOXM1 decreases the interaction between them.(6) Overexpression of FOXM1 decreases oxaliplatin-triggered apoptosis, which is partially alliviated by Mcl-1 knockdown.(7) Suppression of FOXM1 increases oxaliplatin-triggered apoptosis, which is partially rescued by Mcl-1 overexpression.Conclusion(1) Mcl-1 is a novel target gene of FOXM1.(2) FOXM1 directly regulated the transcription of the anti-apoptotic protein Mcl-1 and led to oxaliplatin insensitivity in gastric cancer cells.(3) Targeting FOXM1-Mcl-1 may be a novel strategy to enhance the sensitivity of oxaliplatin in gastric cancer.