Background and ObjectiveWound healing and tissue repair is the integrity of a multiphase process. Contains a variety of cells, extracellular matrix, cytokines and growth factors co-ordination between the functions and interactions. Abnormal wound healing may lead to keloid. Abnormal wound healing, such as:burns, contusions, and surgery lead to irregular skin wound healing, may lead to keloid. Keloids affect the patient’s physical function and appearance, and lead to the psychological problems. It is a challenge for the plastic surgeon to face with because of its high recurrence rate after treatment.Currently, research is focused on keloids in cytokines, growth factors and gene therapy. Transforming growth factor-betal (Transforming growth factor-betal, TGF-β1) is a multifunctional growth factor, and wound healing and scar formation are closely related. Nuclear factor kappa B (NF-κB), connective tissue growth factor (CTGF) and TGF-beta receptor II (T(3RII) is an important intracellular medium in TGF-β1 signaling pathway. TGF-β1 via these pathways regulating fibroblast proliferation. Blocking of TGF-β1 signaling pathway is an effective method of prevention and treatment of keloids.Phage random peptide library is is a very important branch of phage display technology. The principle is to abtain recombinant phage through a large number of random peptides with the filamentous phage coat protein (PⅧor PⅢ) fusion expression, assembly, and thus displayed on the phage particles.The target protein is used to screen phage peptide interacted with. Through the course of analyzing the screened phage peptide structure and sequence, it provides a theoretical basis and experimental support for the protein molecules (such as antigens and antibodies, receptor and ligand, enzyme and substrate) interaction mechanism. Phage random peptide library increasing people’s attention, phage random peptide library technology has built a variety of different peptide libraries depending on the application and different purposes. It has become a effective mathods to explore the interaction between the receptor and ligand binding sites, for the biological activity of high affinity ligand to detect spatial structure of the unknown protein epitope of the tool.It has a wide range of applications in the study of protein molecules recognize each other, the new vaccine and drug development and other areas. From random peptide phage library was screened to obtain a variety of growth factors specific ligands and epitopes, such as CTGF, EGF, FGF and VEGF, etc.The purpose of this study is from a random 12-peptide phage library was screened to obtain TGF-β1 peptide phage simulation. Phage-specific expression similar to the analog peptide may contain exogenous TGF-β1 peptide, may be of TGF-β1 receptor antagonist, and TGF-β1 competitive binding its receptor, thereby inhibiting keloid fibroblast proliferation. Random peptide phage library screening to obtain peptide inhibitor of TGF-β1, to help curb the role of TGF-β1, may provide new opportunities for prevention and treatment of keloids.Materials and methodsPart one TGF-betal related model peptides isolated from a phage display 12-mer peptide libraryHuman TGF-β1 monoclonal antibody for the target, the four bio-panning enriched phage peptide contains the specific simulation. Eluate and the amplicon of the titer determination. Crossed the host bacteria inoculated, cultured for phage amplification. Single colonies were inoculated in the host cell culture medium, count the blue spot, calculate the phage titer. Randomly selected the first four biological panning phage blue plaques, amplified phage were calculated output/ input ratio to assess the recovery of phage. Enzyme-linked immunosorbent assay (ELISA) to detect the binding of monoclonal phage, the phage DNA precipitation, centrifugation, agarose gel electrophoresis detection of DNA extract quality. Phage DNA and-96g III sequencing primers together to send Beijing Genomics Institute Co., Ltd., the dye tracer dideoxy automated sequencing. Application of peptide nucleic acid analog Blast system detects DNA similarity.Part two The study of tgf-β1 phage model peptides on inhibiting keloid fibroblasts proliferationHuman TGF-β1 monoclonal antibody-coated plates, plus peptide library, were selected four, including enrichment of specific phage peptide analog. Limited by the Beijing Genomics Institute of the dideoxy dye tracer automated sequencing. Application of nucleic acid similarity comparison database (Blast System) test the similarity of DNA analog peptides. Total of four phage peptide analog, the next step in vitro test.Identified through the pathology of keloid from training to obtain keloid fibroblasts. Application of tissue culture method to obtain keloid fibroblasts. Thiazolyl blue (MTT) assay the number of living cells to detect TGF-β1 on cell proliferation. A total of 13 groups:including the negative control group, the phage M13 group, TGF-β1 group and the control group and 1 analog peptide phage group 10 group.Application Annexin V-FITC/PI apoptosis detection kit and flow cytometry apoptosis. A total of 5 groups:negative control group and 4 analog peptide phage group. Annexin V-FITC positive and PI-negative cells in that early stage of apoptosis, both of which are positive that the cells in the late stages of apoptosis, both of which are not negative as apoptotic cells.Cell affinity peptide analog detection:A total of 13 groups:including the negative control group, control group M13 phage (1012 pfu/ml), TGF-β1 control group (5 mg/L) and 1 analog peptide group and phage group 10 group (1012 pfu/ ml). Immunofluorescence detection kit according to the operating instructions carefully. Human TGF-β1 monoclonal antibody (red) and M13 coat protein (green) as the primary antibody.Real-time quantitative PCR of keloid fibroblast nuclear factorκB (NF-κB) and connective tissue growth factor (CTGF) expression were detected. A total of 13 groups:including the negative control group, the phage M13 group, TGF-β1 group and the control group and 1 analog peptide phage group 10 group. Application RNAiso reagent extracted epidermal cells of total RNA. Application PrimeScriptTM RT reverse transcription kit obtained cDNA, SYBR Premix Ex TaqTM II application for PCR reaction. Reaction conditions:30 s,95℃; 95℃5 s,58℃31s (40 cycles). Primer sequence:(1)β-actin:upstream:5 TGACGTGGACATCCGCAAAG 3’, downstream:5 ’CTGGAAGGTGGACAGCGAGG 3’ (204 bp);(2) NF-κB:upstream:5’CTGTAACTGCTGGACCCAAGG 3’, downstream:5 ’CTTTTTCCCGATCTCCCAGCT 3’(209 bp);(3) CTGF:upstream:5 ’CCTCTTCTGTGACTTCGGCTC 3’, downstream:5 ’GAACGTCCATGCTGCACAG 3’(188 bp).Application of SPSS 16.0 software for statistical analysis. Result data to said single factor analysis of variance (one-way ANOVA) and Dunnet’s test to analyze differences between the groups, with P<0.05 was considered statistically significant.Results1, TGF-betal related model peptides isolated from a phage display 12-mer peptide libraryAfter 4 rounds of bio-panning, phage obtained and the production rate gradually increased the total, containing specific to obtain analog peptide phage enrichment, ELISA detection of TGF-β1 received standard-absorbance curve. The results obtained phage display screening has good binding activity, sequencing to obtain 10 to promote fibroblast proliferation and inhibition of cell proliferation or the base sequence. Blast through the detection system, in which an analog peptide (No.1) and TGF-β1 is similar to three analog peptides (No.2,5,8) and TGF-beta2 is similar to five analog peptides (No.3,68,10) and TGF-betaⅡreceptor similar to the three analog peptides (No.4,5,8) and TGF-β-inducible factor similar to an analog peptide (No.9) and NF-κB similar to 6 analog peptide (No.4-9) and cell division of the original activated protein kinase (mitogen-activated protein kinase, MAPK) is similar.2, The study of tgf-β1 phage model peptides on inhibiting keloid fibroblasts proliferationDetection at 570 nm absorbance value of A, MTT results showed that the negative control group A of 0.22 (two digits after the decimal point to retain control group M13 is 0.22), TGF-β1 group with different concentrations (0.05,0.5,5μg/L) a-values were 0.29,0.31,0.35, single-factor analysis of variance and Dunnet’s method of analysis showed that TGF-β1 and the negative control group was statistically significant difference between the groups. TGF-β1 group can significantly contribute to keloid fibroblasts (P<0.01). Statistical analysis showed that the M13 phage negative control group and the control group, no significant difference between (P> 0.05), in the negative control group and the analog peptide phage group 5 and 6 between the groups, as well as the negative control group and the low concentration of (1010 pfu/ml) of section 7,10 analog peptide phage group no significant difference between groups (P> 0.05), but the negative control group and the other phage peptide analog difference between groups was statistically significant (P<0.05), simulation results suggest that four kinds of phage peptides (7 to 10 groups) can inhibit the proliferation of keloid fibroblasts.The results of MTT to inhibit keloid fibroblast proliferation of the four phage peptide analog (7 to 10 group), further assessment of keloid fibroblasts to promote apoptosis. Relative to the negative control group, these four phage peptide analog (7 to 10 groups) to mild keloid promote apoptosis, can induce apoptosis in keloid fibroblasts in the late stage.Immunofluorescence showed that TGF-β1 control group and 10 analog peptide phage group with a combination of keloid fibroblasts, but not the control group phage M13 and keloid fibroblasts combined.Real-time PCR detection of TGF-β1 control group and the analog peptide phage group (1 to 10 groups) NF-κB and the expression of CTGF levels and negative control (expression set to 1) compared to, TGF-β1 group and 1 to 4 analog peptide phage group of NF-κB and increased expression of CTGF,5 to 6 analog peptide phage group did not change significantly, and the first 7 to 10 analog peptide phage group expression decreased. One expression of NF-κB is a negative control group were 0.28,0.26,0.46,0.30 times, CTGF expression is the negative control group were 0.26,0.60,0.34,0.17 times.Conclusions1, twelve from phage random peptide library can be panned to the TGF-β1 associated with the analog peptide phage.2, Four kinds of phage peptide analog with a combination of keloid fibroblasts and keloid fibroblasts promote mild mild late apoptosis.3, phage peptides may be simulated by regulating NF-κB and the expression of CTGF to regulate the proliferation of keloid fibroblasts. |