Role Of TLR4 For Paclitaxel Chemotherapy In Human Epithelial Ovarian Cancer Cells

BackgroundTLRs(toll-like receptors) are the transmembrane proteins,which were initially found in Drosophila during embryogenesis.There is high homologous for TLRs between mammalian and Drosophila.The main features of TLRs are that it containing leucine-rich repeat structure in Extracellular.TLRs are belonging to the members of IL-1R superfamily 1,which worked as a sentine at the host's natural immune response.There are about 10 kind subtypes of TLRs found in human cells.TLR4 is a subtype of TLRs that was initially discovered in mammals,which acquires high homologous to TLRs in Drosophila.Myeloid differentiation factor 88(MyD88) was first described as a myeloid differentiation primary response gene.It was later suggested to be the critical adaptor in TLR4 signalling pathway.Further advances in the understanding of TLR4 show that TLR4 signaling is divided into MyD88-dependent and MyD88-independent(TRIF-dependent) pathways.The immune system recognizes the presence of bacterial pathogens through the expression of TLRs.Recent studies found TLR4 was overexpressed in the cells of gastric carcinoma,hepatocellular,human prostate carcinoma,and lymphomas etc.Moreover,it had been reported that the Asp299Gly variant of TLR4 was positively associated with the tumor pathogenesis and progression.Fukata et al.reported that TLR4 was overexpressed in human and murine colorectal neoplasia.And TLR4-normal mice(C3H/HeN mice) were more susceptible to colon carcinogenesis than TLR4-deficient mice(C3H/HeJ mice).Cianchi et al. reported that TLR4 induced the immune escape in tumor cells by inhibiting its apoptosis.In the research of cutaneous skin carcinogenesis,it showed that the C3H/HeJ mice developed more tumors by treatment of DMBA than that of C3H/HeN mice.The results indicate that TLR4 plays an important role in the prevention of skin tumor induced by DMBA.TLR4 is a double-edged sword for carcinogenicity in different tissues,which becomes a research hotspot in non-immune areas,especially in the field of tumor.Ovarian cancer is the most common malignant tumors in women,which is a serious threat to the lives and health of women.In ovarian cancer,nearly 70%of the patients is suffered in advanced or has been transferred at the time of diagnosis. Cytoreductive surgery with concomitant paclitaxel and platinum-based chemotherapy is the main treatment method for ovarian cancer.Paclitaxel is a product of the Pacific yew and its anti-mitotic actions are due to its ability to bind and stabilize microtubules, which prevented proper cell division during mitosis.Paclitaxel is a firstline chemotherapeutic agent used to the treatment of ovarian cancer.But the emergence of paclitaxel resistance make the tumor recurrence.And the total five-year survival rate is only around 40%in ovarian cancer patients.It has been reported that TLR4 is expressed in some ovarian tumors and ovarian cancer cells.Data show that TLR4 signalling is correlated with paclitaxel resistance. And paclitaxel is a known TLR4 ligand.In the study of Kelly et al,it supposes that paclitaxel evokes TLR4/MyD88 signalling,activating protein kinase C(Akt/PKC), which further activated NF-κB.And the downstream signal factor TAB1 of TLR4 pathway(TAK1-binding protein 1) can increase the expression level of XIAP which inhibit TRAIL apoptosis pathway through down-regulating of caspase-8 expression.RNA interference(RNAi) refers to the efficient specific degradation of homologous mRNA phenomenon which is induced by double-stranded RNA(dsRNA).RNAi mainly blocks gene expression in post-transcriptional level,and we can use this technique to investigate the function of some genes.At the same time,we can turn off non-essential gene or change gene expression in the human body.In mammals,we have a variety of strategies to knock down the expression of mRNA.And siRNA expression vector is the most stable and durable method.Therefore,we can find more appropriate target genes for RNAi interference.And it can help us to explore in detail the complex biological behavior of tumor cells.In the research,RNAi technique was used to knock down the expression of TLR4 in ovarian cancer cell lines SKOV3(MyD88~+) and A2780(MyD88~-) in order to find out whether TLR4 RNAi could increase paclitaxel chemosensitivity in MyD88~+ cells.We hope that the RNAi might provide a new target for clinical treatment of ovarian cancer. The research is divided into two parts:the one is to construct RNAi expression vector to knock down TLR4 expression in human epithelial ovarian cancer cells;the other is to investigate the role of TLR4 for paclitaxel chemotherapy in ovarian cancer cells.PARTⅠTHE CONSTRUCTION OF THE RNAi EXPRESSION VECTOR AND ITS EFFECTS ON THE TRANSFECTED OVARIAN CANCER CELLSObjective:To construct the RNAi expression vector for TLR4,and study its inhibition role on TLR4 gene in the ovarian cancer cells.Methods:1.The construction of RNAi expression vector for TLR4(1) Design of siRNA sequence:Sequence specifically targeting TLR4 were confirmed to be valid by a previous report with following:5'-CGATGATATTATTGACTTA-3' (sense) and 5'-TAAGTCAATAATATCATCG-3'(antisense).And the negative control was used in all the experiments.The sequence of the "interference" target site is 5'-GACTTCATAAGGCGCATGC-3',which bears no homology to any sequences in the human genome database.Therefore,the transcript-hairpin siRNA is expected to have no interference on human genes.(2) Design and construction of siRNA oligonucleotides:According to the design,the whole oligonucleotides template chain is as follow:5'-GATCCCGATGATATTATTGACTTATTCAAGACGTAAGTCAATAAT ATCATCGTTTTTTGTCGACA-3'.And the negative control sequence is as follow: 5'-GATCCGACTTCATAAGGCGCATGCTTCAAGACGGCATGCGCCTTATGAAGT CTTTTTTGTCGACA-3'.(3) The connecting of template strand siRNA and the vector: The vector and siRNA template chain was connected according to reaction system instructions.The new synthetic recombinant plasmid was named to be pGenesil-sh TLR4(target gene) and pGenesil-shControl(negative control).(4) Recombinant plasmid transformation and extraction:The recombinant plasmid was transformed into E coli.DH5a.After screening kanamycin-resistant(kanar~r) clones,the plasmids were collected.(5) Enzyme digestion and DNA sequencing:The recombinant plasmid vectors(pGenesil-shTLR4 and pGenesil-shControl) were identified by SalI enzyme digestion.And the positive bacilli were sent to Wuhan Crystal Biotech Company for sequencing.2.Investigate the effect of TLR4 gene silencing(1) pGenesil-shTLR4,pGenesil-shControl were transfected into SKOV3 and A2780 cells.Subclone cells(SKOV3/shTLR4,SKOV3/shControl,A2780/shTLR4 and A2780/ shControl cells) were obtained by G418 selection.(2) The expression level of TLR4 and MyD88 in SKOV3 and A2780 cells were analyzed by RT-PCR and Western blot methods.Results:1.The construction of the TLR4 RNAi vector(1) The pGenesil-shTLR4 and pGenesil-shControl was digested by SalI enzyme and prepared for agarose gel electrophoresis,A 400bp of DNA band was observed under ultraviolet.The recombinant plasmids are in line with the design requirements.(2) The sequencing results showed that the two constructing eukaryotic expression vectors have been identifed to contain the designed siRNA fragments,which comply with design requirements.2.Identification of TLR4-specific siRNA plasmid transfected in ovarian cancer cells.(1) Stable subclone cells(SKOV3/shTLR4,SKOV3/shControl,A2780/shTLR4 and A2780/shControl cells) were obtained after selected with G418 for 4 weeks.(2) The results by RT-PCR and Westemblots showed that in the parental SKOV3 and A2780 cells,TLR4 were expression at both mRNA and protein levels.MyD88 expressed in SKOV3 cells(MyD88~+),but it hardly expressed in A2780 cells(MyD88o);The TLR4 RNAi expression vector transfected into SKOV3 and A2780 ovarian cancer cells were confirmed to own the interference effects both in mRNA and protein expression level.Conclusions:1.We have succeed in building the TLR4 gene siRNA plasmid expression vector with the genetic engineering techniques.2.The pGenesil-shTLR4 was demonstrated to have inhibiting effect on the expression of endogenous TLR4 gene levels in SKOV3 and A2780 cells.PARTⅡROLE OF TLR4 FOR PACLITAXEL CHEMOTHERAPY IN HUMAN EPITHELIAL OVARIAN CANCER CELLSObjective:1.To observe the role of TLR4 for paclitaxel chemotherapy by detecting caspase3/7 activity,the changes of cells growth inhibition rate and cell cycle,in human epithelial ovarian cancer cells SKOV3 and A2780.2.To explore the mechanism of TLR4 on paclitaxel responsiveness in SKOV3 and A2780 cells by analyzing of some proteins in apoptosis pathway.Methods:1.The caspase-3/7 activity was analyzed by Caspase-Glo 3/7 detection kit after inhibition of TLR4 in SKOV3 and A2780 cells in the presence of paclitaxel.2.MTT assay were used to evaluate the cell growth inhibition rate(GIR) in SKOV3/shTLR4,SKOV3/shControl,A2780/shTLR4 and A2780/shControl cells in the presence of paclitaxel.3.The cell cycle distribution was investigated by Flow cytometry(FCM) in pre-and post-RNAi in SKOV3 and A2780 cells.4.The expression of XIAP and Akt proteins were detected by Western blot in SKOV3/shTLR4,SKOV3/shControl and A2780/shTLR4,A2780/shControl cells.Results:1.The caspase-3/7 activity was increased significantly in MyD88~+ cell line SKOV3/ shTLR4 treated by paclitaxel,compared with that of SKOV3/shControl cells.There was on significant difference on caspase-3/7 activity between A2780/shControl, A2780/shTLR4 cells.2.The GIR of SKOV3/shTLR4 cells was 59%in the presence of 2μM Pac for 24h, which was significantly higher than those of the parental SKOV3(29%) and SKOV3/ shControl cells(31%)(p＜0.001).No significant difference was observed on the proliferation among the three types of A2780 cells.3.The cells entry into the S phase was strongly inhibited in SKOV3/shTLR4 cells compared with the SKOV3/ shControl cells(p＜0.01).In contrast,no difference in spontaneous apoptosis was detected between A2780/shTLR4 and A2780/shControl cells.4.Moreover,the expression of XIAP and phosphorylated Akt(pAkt) in SKOV3/ shTLR4 cells were evaluated on different time of paclitaxel treatment.The results showed that the expression of pAkt was decreased significantly after 6 hours of paclitaxel treatment.XIAP levels was decreased 12 hours after treatment.In contrast, no change on the levels of total Akt was observed.But in A2780/shTLR4 cells,there was no significant change in expression of pAkt and XIAP.Conclusions:1.TLR4 inhibited SKOV3 cells(MyD88 expression positive) apoptosis,and the downregulation of TLR4 can enhance the sensitivity of SKOV3 cells to paclitaxel.2.The knockdown of TLR4 inhibited the expression of XIAP and pAkt in SKOV3/ shTLR4 cells,indicating that the knockdown of TLR4 might depress Akt pathway,and enhanced paclitaxel chemosensitivity.