| BACKGROUND AND OBJECTIVEThe incidence of nasopharyngeal carcinoma(NPC)is most prevalent in Southeast Asia,particularly in Southern China.NPC is distinctive among the head and neck carcinomas for its marked tendency to metastasis and invasion.It has been shown that at the time of diagnosis,60-85%of NPC patients already have clinically detectable aggressive metastasis in the regional lymph nodes,in distant organs such as the lungs and in bone.So far there is still no effective treatment for NPC at the stage of metastasis.As a result,prognosis of NPC is poor and the 5-year survival rate is less than 50%.Meanwhile,the mechanisms that control NPC metastasis remain poorly understood.Epstein-Barr virus(EBV)encoding latent membrane protein-1(LMP-1)is a primary oncoprotein in NPC.It has been suggested to contribute to the highly metastatic nature of NPC.LMP-1 functions as a constitutively active tumor necrosis factor receptor(TNFR)and contributes to multiple aspects of NPC,mainly through activating a number of signaling pathways,including NF-kB,AP-1,ets-1,MAPKs, and JAK/STAT,and controlling the expression of metastasis related gene,such as E-cadherin,matrix metalloproteinase(MMPs),c-Met,VEGF,EGFR and COX-2. Knock down of LMP-1 reduces the metastasis abilities of NPC cells. MicroRNAs(miRNAs)are 19-25 nt regulatory RNAs that participate in the regulation of various biological functions in numerous eukaryotic lineages,including plants,insects,vertebrate,and mammals.miRNAs can have pleiotropic effects on cell proliferation,apoptosis,and cell differentiation.They are generally believed to act by binding to imperfectly complementary sequences in the 3' untranslated region of the target genes,resulting in decreased translation or degradation of the target transcript. Bioinformatic and experimental evidence indicate that each miRNA may target several dozen to several hundred gene transcripts,thus allowing for coordinated and combinatorial regulation of multiple genes by miRNAs.More than 1000 miRNAs have been identified in humans so far,and many of the genes in the human genome are predicted to be subject to miRNA regulation.The expression of many miRNAs is usually specific to a tissue or developmental stage,and the miRNA expression pattern is altered during the development of many diseases miRNAs are integral to gene regulation,apoptosis,hematopoietic development,and the maintenance of cell differentiation.There are a growing number of examples of particular miRNAs whose expression is increased in cancer(i.e.,mir-21,the mir-17-92b cluster,mir-155,and mir-372/373)whereas the expression of other miRNAs is decreased in tumor versus normal cells.miRNAs that have been experimentally shown to directly induce tumor have been termed"oncomirs",with the first example being the mir-17-92b cluster. Metastasis is a central problem in cancer,yet the underlying mechanisms remain poorly understood.The involvement of miRNAs in the development of metastases has come under intense scrutiny in recent years.Members of miR-17-92 family, miR-200 family,miR-205,miR-29C,miR-21 and Let-7 were proved to be involved in cancer metastasis. Ma and coworkers from Robert Weinberg's group found that miR-10b initiated breast cancer invasion and metastasis.They also found that Twist,a metastasis promoting transcription factor,could induce miR-10b expression and demonstrated that miR-10b was an essential element in the Twist-induced metastasis program. Others' work showed that induction of Twist by an Epstein-Barr virus (EBV)-encoded human viral oncoprotein latent membrane protein-1(LMP-1)directly contributes to the metastatic nature of NPC.Therefore,here we explored whether miR-10b could be induced by EBV oncogene LMP-1,and its association with Twist as well.We took advantage of an established pre-miR-10b lentiviral vector and RNA interference technology to determine the relationship between EBV LMP-1 and miR-10b,and how induction of miR-10b by LMP-1 might contribute to the highly metastatic feature of NPC.We first showed that LMP-1 could activate miR-10b,and possibly via Twist,and miR-10b stimulated cell migration and invasion in vitro.We showed next that in cell culture,blocking of miR-10b could directly inhibit the invasion behavior of miR-10b over-expressed NPC,but we did not find such effect in control cells without miR-10b over-expression.We established a NPC metastasis model in mice by transplanting miR-10b over-expressed EBV-positive NPC cells,C666/shLMP-l/miR-10b,in the livers of nude mice and observed lung metastasis.Metastasis was detected in lung and liver,while no metastasis was found when miR-10b over-expressed EBV-negative non-metastatic NPC cells were transplanted into mice.This report suggested that miR-10b facilitates the metastasis of EBV related NPC cells,but miR-10b gene might temporarily not be considered as a therapeutic target for NPC metastasis. MATERIALS AND METHODS1.Expression characteristics of miR-10b in NPC tissuesThis study was conducted on a total of 45 NPC samples(26 metastatic NPC and 19 non-metastatic)and 16 chronic nasopharyngitis samples.All the samples was divided into two.One part of the specimen was made into frozen-section for miR-10b in situ hybridization,the other for paraffin section and immunohistochemistry analysis of LMP-1.2.Expression characteristics of miR-10b in NPC cellsQuantitive real-time PCR was used to detect the expression of miR-10b in 7 NPC-derived cell lines(HNE1,HONE1,CNE1,CNE2,5-8F,6-10B,C666-1,)and immortalized nasopharyngeal epithelial cells NP69.3.miRNA isolation and Real-time PCRCells were collected and miRNAs were prepared using MirVana miRNA isolation kit and RT reactions were performed using TaqMan MicRNA RT Kit(ABI, USA).Real-time PCR was performed with TaqMan Universal Master Mix(ABI) using Mx3000P real-time PCR instrument(Stratagene,USA).U6 RNA was used as an endogenous control for miRNA detection.The data were analyzed using the standard curve analysis.4.Knockdown and overexpression of LMP-1To stably knockdown of LMP-1,C666-1 cells were transfected with shRNA vector pAVU6+27/shLMP-l targeting LMP-1(CATAGGCCTTGCTCTCCTTCTCC) using the lipofectamine 2000 reagent(Invitrogen)following the protocol provided by the manufacturer.Forty-eight hours later,cells were harvested and plated on 10 cm tissue culture plate,and clones stably expressing shRNA(C666/shLMP-l)were selected using 400μg/ml G418.To overexpression of LMP-1,C666-1 cells were transfected with N-LMP-1 cDNA containing vector pCR~?Ⅱ-TOPO/LMP-l(A kindly gift of professor Marie C.Lin from the Department of Chemistry,The University of Hong Kong,China)using the lipofectamine 2000 reagent following the protocol provided by the manufacturer.Forty-eight hours later,cells were harvested and LMP-1 mRNA was detected by RT-PCR.5.Lentiviral vector mediated overexpression of miR-10bTo generate a miR-10b expression vector,miR-10b precursor pre-miR-10b was amplified by PCR and cloned into pLVTHM vector(GFP-encoding)and transfected with psPAX2 and pMD2.G into 293FT using lipofectamine 2000 to package lentivirus pLVTHM/miR-10b.Cells were infected.After 3 days,cells were sorted by BD FACSAriaⅡcell sorter(Becton-Dickinson Labware)to selectively amplify GFP-positive cells.miR-10b mRNA expression after infection of lentiviral vector was revealed by real-time PCR.6.Oligonucleotide transfectionTwist siRNA(AAGCTGAGCAAGATTCAGACC),its control siRNA and anti-miR-10b miRNA inhibitor were transfected using Lipofectamine 2000 (Invitrogen)following the protocol provided by the manufacturer.7.MTT assayMTT assay was performed to assess the effect of miR-10b on cell proliferation. Cells(1×10~3cells/well)were plated in a 96-well plate and maintained in RPMI-1640 supplemented with 10%FBS.At 24,48,72,96 and 120h after seeding,culture medium was removed,cells were treated with 20μl sterile MTT dye(5mg/ml,Sigma, USA)for 4h at 37℃,and then 200μl of DMSO was added and thoroughly mixed for 30min.Spectrometric absorbance at wavelength of 570nm was measured on a microplate reader.8.Flow cytometryCell cycle profiles are analyzed by flow cytometry.Cells(5×l0~5cells/well) were plated in a 6-well plate and were transfected.After 48 h,cells were collected and washed three times in PBS.After resuspension,solution A,B and C from fluorescence labeling kit were added to label DNA.Sample analysis was performed by flow cytometry(BD FACSAriaⅡcell sorter,Becton-Dickinson Labware).The cell cycle phase distribution was calculated from the resultant DNA histogram using Multicycle AV software(Phoenix Flow System,San Diego,CA,USA).9.Wound healing assaysIn vitro wound healing assay was carried out to determine the ability of cells to form membrane protrusion and cell migration.Equal numbers of cells(1×10~5)were seeded into six-well cell culture plates.When the confluence reached 90%,a single wound was created in the center of the cell monolayer by gentle removal of the attached cells with a sterile plastic pipette tip.The debris was removed by washing the cells with serum free medium.Migration of cells into the wound was then observed at different time points.A total of nine areas were selected randomly in each well under a 40×objective and cells in three wells of each group were quantified in each experiment. 10.In vitro Matrigel invasion assayCell invasiveness was determined in vitro by the ability of the cell to transmigrate a layer of extracellular matrix(ECM)in Matrigel in Biocoat Matrigel Invasion Chambers(Becton-Dickinson Labware,Bedford,MA).Cells were plated at a density of 5.0×10~3 cells/insert,respectively.Medium with 10%FBS was added to the lower chamber as a chemoattractant.After 24 h incubation,cells on the upper surface of the membrane were removed.Invasive cells,which were able to breach the 8μm pores and grow on the lower surface,were fixed in 100%methanol,stained with 1%Toluidine(Sigma),and counted under an inverted microscope(Leica,German). The cells were counted in three random optical fields(200×magnification)from duplicate experiments.11.Construction of miR-10b reporter plasmids and luciferase assaysComplement fragment of miR-10b(ACAAATTCGGTTCTACAGGGTA)was cloned into psiCHECKTM-2 Vector(Promega,Madison,WI)downstream of the Renilla luciferase cDNA.Luciferase activity was assayed using Dual-Luciferase Reporter Assay System(Promega,USA)following the protocol provided by the manufacturer.12.In vivo metastasis experimentNude mice(BALB/c nu/nu,4-6 weeks old,18-24 g in weight)were purchased from Charles River Labs(Wilmington,WA)and were maintained under pathogen-free conditions(specific pathogen-free level).Mice were divided into two treatment groups(n=18/group),primary tumors were established by direct injection of 2×10~6 C666/shLMP or C666/shLMP-l/miR-10b into the liver as previously described.Nine mice from each group were randomly chosen for long-term survival study on day 10.The remaining nine mice were sacrificed on day 21,and tissues were collected for pathologic analysis.GFP fluorescence images were observed under an in vivo fluorescence instrument.13.Statistical analysisAll analyses were carried out using the SPSS 13.0 software package.Expression of miR-10b in relation to clinical data was analyzed with the Mann-Whitney U test. Comparison of mean was analyzed by one-way ANOVA and Student-Neuman-Keuls method for multiple comparison.Dunnett's T3 method was employed for heterogeneity of variance.Survival curves were plotted by the Kaplan-Meier method and compared by the log-rank test.The X~2 test for proportion was used to analyze the in vivo metastasis characteristics of different groups.Factorial analysis was utilized to analyze the results MTT,invasion and wound healing assays.The differences in wound migration and invasion indices between C666-1 cell clones were analyzed by the independented t test.A P value less than 0.05 was considered statistically significant.RESULTS1.miR-10b was over-expressed in metastatic NPC samples and was correlate with LMP-1 expressionIn situ hybridization results showed that,although there is no difference of miR-10b expression between NPC(36/45)and chronic nasopharyngitis(9/16) samples(X~2=3.441,P=0.097),miR-10b was positively associated with NPC metastasis(Z=-3.243,P=0.001).Furthermore,expression of miR-10b was correlated with LMP-1 expressing(Z=-2.013,P=0.044).In LMP-1(+)samples,metastatic NPC present higher miR-10b rate than non-metastatic ones(Z=-2.504,P=0.012). However,the same thing didn't happened in LMP-l(-)cases(Z=-1.857,P=0.063). 2.miR-10b was over-expressed in metastatic NPC cells and its expression was correlate with LMP-1 expressionUsing real-time PCR,miR-10b expression in 7 NPC-derived cell lines(HNE1, HONE1,CNE1,CNE2,5-8F,6-10B,C666-1,)and immortalized nasopharyngeal epithelial cells NP69 were examined.The results showed that the expression of miR-10b in 8 cell lines was significantly different from each other(F=96.395, P=0.000).And expression of miR-10b was significantly increased in the metastatic C666-1 and 5-8F cell comparing with the non-metastatic NPC cells.In situ hybridization showed negative miR-10b expression in 6-10B,HONE and strongly positive in C666-1 and 5-8F which supported the real-time PCR results.To test whether miR-10b was regulated by LMP-1,LMP-1 expression in C666-1 cells was down-regulated by RNAi and isolation of clones C666/shLMP stably expressing shRNA targeting LMP-1 or up-regulated by transfecting the expression plasmid pCR?Ⅱ-TOPO/LMP-l.Real-time PCR showed that when LMP-1 expression was down-regulated,the expression of miR-10b was correspondingly decreased(C666-1 vs C666/shLMP-l);when LMP-1 expression was up-regulated,the expression of miR-10b was also increased(C666-1 vs C666/LMP-1).These results correlated miR-10b expression with LMP-1 expression and aggressive tumor phenotypes.3.Establishment of miR-10b over-expression cloneC666/shLMP was infected by pLVTHM/pre-miR-10b lentiviouas vector and were sorted by BD FACSAriaⅡcell sorter.the selected GFP~+ clone was named C666/shLMP/miR-10b,and miR-10b level of which is about 45 folds that of C666/shLMP. 4.Over-expression of miR-10b had no effect on cell proliferation and cell cycleTo determine whether over-expression of miR-10b could increased cell proliferation,we compared the growth rates of miR-10b and vector-transduced cells. We found no statistically significant differences between them by MTT proliferation assays.Similarly,no change in cell cycle was observed by flow cytometry analysis in miR-10b over-expressed cell.5.Over-expression of miR-10b increased cell mobility and invasionActive cell motility is a rate-limiting step of rumor cell invasion.The mobility of NPC cells was measured using a well-established in vitro wound-healing assay.The miR-10b expressing C666/shLMP-l cells displayed a significantly higher cell invasion activity as compared to the control C666/shLMP-l cells.At 8 h after wound formation,C666/shLMP-l/miR-10b cells had fully migrated towards the open wound.This result suggested that over-expression of miR-10b by lentiviral vector led to a significant increase in the migration of the cells.These results indicated that over-expression of miR-10b increased cell invasion,supporting a role for miR-10b in the metastasis of EBV positive NPCs.Invasion of basement membranes by tumor cell is best approximated in vitro by evaluating the transmigration of a biologically active matrix such as Matrigel. Therefore,we measured the ability of these cells to transmigrate through the Matrigel membrane.We found that the miR-10b transfected C666/shLMP-l cells displayed a significantly higher transmembrane migration activity as compared to the mock transfected c666/shLMP-l cells.6.miR-10b over-expression promoted NPC metastasis in vivo To determine whether miR-10b over-expression could shorten the lifespan of the nude mice,the nude mice were divided into two treatment groups(n=18/group) with the primary tumors being established by either direct injection of 2×10~6 C666/shLMP-l or C666/shLMP-l/miR-10b under the liver capsule.Nine mice from each group were randomly chosen for long-term survival study.The average survival period of the miR-10b over-expressed group was significantly shorter than the C666/shLMP-l inoculation control group(X~2=5.526,P=0.019).Liver morphologies from these two groups of nude mice in NPC metastasis study were then evaluated 21 days after tumor inoculation.In the nude mice study(n =9),livers from 77.8%of C666/shLMP-l/miR-10b and 33.3%of C666/shLMP-l treatment mice displayed multiple metastasized tumors of different sizes on the surface of the liver.Most of the control C666/shLMP-treated mice showed normal lung morphology with no signs of tumors,whereas the C666/shLMP/miR-10b treated mice clearly showed multiple lung tumors(X~2=5.844,P=0.016).In addition, C666/shLMP-l/miR-10b treatment also significantly enhanced the development of ascites fluid accumulations(X~2=5.556,P=0.018).Moreover,in miR-10b over-expressed non-metastatic HNE-1-treated mice,no indication of lung and liver metastasis could be found in these mice.7.Inhibition of miR-10b expressionTo determine the effect of lowering the expression of miR-10b,we transfected antisense oligonucleotides anti-miR-10b into NPC cell lines.Effective miR-10b silencing,which was demonstrated by luciferase assay,strongly suppressed the invasive behavior of miR-10b-highly-expressed C666/shLMP-l/miR-10b cells in ECM invasion assays.These results suggested that over-expression of miR-10b increased cell invasion,supporting a role of miR-10b in the metastasis of EBV positive NPCs.8.Twist induced miR-10b expression in metastatic NPC cellsTranscription factor Twist has been newly implicated in miR-10b related dissemination of breast carcinoma cells.We explored whether Twist could affect miR-10b expression in NPC cells.Twist siRNA was used to knockdown the expression of Twist.After 72 h of transfection,miR-10b was decreased by 87.4%in C666-1 cells.Similar result was also observed in C666/LMP-1 cells.While in miR-10b over-expressed C666/shLMP/miR-10b cells,the expression of miR-10b did not change with Twist RNAi.These results demonstrated that Twist was involved in miR-10b expression in metastatic NPC cells.Because Twist has been demonstrated to be induced by LMP-1,LMP-1 might modulate miR-10b expression via Twist.CONCLUSIONS1.Expression of miR-10b is up-regulated in the metastasis NPC tissues and cells2.Elevated miR-10b expression promotes NPC aggressiveness,likely by increasing the metastatic cells activities.3.The LMP-1/Twist signaling pathways would promote metastasis partly by up-regulating miR-10b.4.miR-10b could prove to be useful prognostic markers,but further investigation is needed to confirm whether it would be a therapeutic target for NPC metastasis needs. |