| Background and AimsOvarian cancer is one of the most common cancers in females and the leading cause of death from gynecological malignancy in the world.Because the ovaries are located in the deep bottom of pelvis and early-stage ovarian cancer is generally asymptomatic,and lack of effective diagnosis and treatment methods,approximately 75%of patients present in advanced stages(â…¢orâ…£) and lost the chance for radical operation treatment.The ovarian cancer calls also are easy to appear resistance to chemotherapy.The 5-year survival in patients with advanced stage ovarian cancer is only 30%.But,the 5-year survival in patients with stageâ… is more than 90%. Therefore,study on the methods of early diagnosis and new effective therapy is the focus of ovarian cancer research recently.Lysophosphatidic acid(LPA) is the simplest phospholipid,and mediates multiple biological functions through the LPA receptors which have been proposed to mediate LPA signal transduction pathway for multiple biological actions.Recent studies show that LPA is elevated in ascites and plasma of ovarian cancer patients. More than 90%patients with stageâ… ovarian cancer have higher levels of LPA than that of healthy women.The sensitivity of LPA to diagnose ovarian cancer in stagesⅡ~Ⅳis 100%,and both of the sensitivity and specificity are higher than CA125 that is a common tumor biomarker used in clinical practice.Therefore,LPA is proposed as a potential and novel biomarker for ovarian cancer diagnosis and prognosis.LPA has three high affinity receptors,Edg2,Edg4 and Edg7,which belong to the members of the endothelial differentiation gene family(Edgs).Edg2 expresses stably in normal ovarian epithelial cells,and has low expression in ovarian cancer cells.Edg4 and Edg7 are overexpressed in the ovarian cancer epithelial cells.The results above suggest that the high level expression of Edg4 and Edg7 maybe related to tumor-promoting effect of LPA in ovarian cancer development and progression.The combination of LPA with Edg4 and Edg7 can activate four cell signaling transduction pathways and promote ovarian cancer cell proliferation,survival,differentiation, migration,angiogenesis and metastasis,and closely relate to the cancer occurrence, development,progression,invasion,metastasis and resistance to chemotherapeutic agents.Human lipid phosphate phosphohydrolase-3(hLPP3) is a cell surface protein that exhibits ectoenzyme activity and is a number of lipid phosphate phosphohydrolase family(LPPs) that express extensively in cells.It can hydrolyze LPA and decrease the level of extracellular LPA and inhibit the function of LPA. Janos reported that transfecting the ovarian cancer cell line SKOV3 with the vector containing hLPP3 gene could decrease significantly the clon formation of cancer cells, and inhibit cancer cell growth and increase cell apoptosis in vivo.Therefore,it may be a new and effective way to treat ovarian cancer by affecting the metabolism of LPA, blocking LPA receptors,interfering with the signaling transduction pathway of LPA.The study on the action and relationship between LPA and ovarian cancer is still a new project,and there are many problems that are unclear.Three objectives will be done in this study:1) to explore the feasibility of LPA as a early diagnostic biomarker for ovarian cancer and verify the important action of LPA and its receptors in promoting ovarian cancer development by detecting the LPA level in serum of patients with ovarian epithelial cancer and examining the expression of Edg4 and Edg7 in epithelial ovarian cancer tissues with immunohistochemical method.2) to explore the regulation effect of hLPP3 on LPA and inhibition on ovarian cancer cells growth in vitro and in vivo by enhancing the gene expression of hLPP3 in cancer cells. 3) to explore the inhibition efficacy of blocking LPA signaling transduction pathway by silencing Edg4 and Edg7 with RNAi technology in vitro and in vivo.The aim is to identify the new and effective way and potential targets for early diagnosis and gene therapy of ovarian cancer.Part 1 Expression and Significance of LPA and its receptors in serum and tumor tissue of patients with ovarian cancerMaterial and Methods1.Detection of serum LPA level1.1 Patients:Seventy patients with epithelial ovarian tumor were selected in this study,which included 50 malignant cases(37 cases of serous cystadenocarcinoma,13 cases of mucous cystoadenocarcinoma,WHO,2000),including 10 patients with primary early stage(stageâ… ) group,20 with primary advanced stage(stageⅡ~Ⅳ) group(FIGO,2000) and 20 with relapsed ovarian cancer group,the ages of patients were 30~69 years old,and the average was 51.3±5.6 year;20 benign cases(13 cases of serous cystadenoma,6 cases of mucous cystadenoma and 1 case of endometrioid tumor),the range of ages was 24~63 years,the average was 46.7±8.7 years.Twenty normal women were also selected as controls,the ages were 28~70 years,the average was 47.6±9.7 years.All cases were confirmed by pathology after operation.1.2 Meehods:Levels of serum LPA were detected by biochemistry assay and those of tumor antigen 125(CA125) were measured by radio-immunoassay.Then the two results were compared to evaluate the value of LPA to diagnosis of ovarian cancer, especially to early stage of ovarian cancer.2 Examination of Edg4 and Edg7 proteins in epithelial ovarian tumor tissues2.1 Specimens:Sixty-eight specimens of epithelial ovarian tumor paraffin-imbedded and archival tissues and 12 cases of normal ovarian tissues were resected and collected at department of gynaecology and obstetrics between February of 2000 and October of 2004.All specimens were diagnosed by two pathologists and all patients had not accepted the radiotherapy and chemotherapy before operation with complete clinical and pathological information.Eighty samples included normal ovarian tissues (12 cases),benign epithelial ovarian tumors(10 cases),borderline epithelial ovarian tumors(10 cases) and malignant epithelial ovarian cancers(48 cases),while 48 malignant cases were divided into serous cystadenocarcinoma(30 cases),mucous cystoadenocarcinoma(11 cases) and endometrioid carcinoma(7 cases) according to WHO 2000 standard.Their FIGO staging was stageâ… (12 cases),stageâ…¡(16 cases), stageâ…¢(18 cases) and stageâ…£(2 cases),their histological staging was G1 grade(14 cases),G2 grade(16 cases),G3 grade(18 cases) according to histological grade.Their subgroups included lymphoid node metastasis(22 cases) and non-lymphoid node metastasis(26 cases),ascites quantity more than 500ml(30 cases) and ascites quantity less than 500ml(18 cases).The patients' ages were from 31 to 60 years old,mean of age was 42.6±4.7 years,and the ages of women with normal ovaries were 34~59,the average age was 45.4±6.3years.2.2 Methods:The Edg4 and Edg7 protein expression in epithelial ovarian tumor was detected by immunohistochemical assay(streptavidin-biotin -peroxidase complex staining assay).The relationship between expression of Edg4 and Edg7 proteins and the clinical parameters,such as clinical stage,pathological grade,ascites quantity,lymphoid node metastasis,etc.were investigated and analysed.3 Statistical analysisThe measurement data were presented as mean+SD((?)±s),the comparison of multi-sample means was dealt with using one-way analysis of variance(ANOVA) and least significant difference(LSD) test;numeration data were expressed as n(%),the comparisons of groups were done using contingency table Chi-square test,Fisher's Exact test and Kruskal-Wallis test.Spearman rank correlation analysis was used to analyze the relevance.Analyses were performed using statistics software SPSS13.0 package,and P<0.05 represented significance.Results1.Levels of serum LPA in patients with different stages(â… -â…£) epithelial ovarian cancer were significantly higher than those in normal women and benign epithelial ovarian tumor(P<0.001),but serum LPA level of every epithelial carcinoma group had no statistical significance(P>0.05),such as patients with stageâ… (early stage) had no difference compared with the advanced patients(stageⅡ~Ⅳ).The same result was obtained from the comparison of normal women and benign cases(P>0.05) although there was a slight raise in benign cases.CA125 levels in primary ovarian cancer with advanced and relapsed groups were significantly higher than those in early stage group,benign tumor group and normal women group(P<0.001),but in early stage it was just a little higher than those in benign tumor group and normal women group, then there was no statistic significance(P>0.05).2.Serum LPA increase used to diagnose epithelial ovarian carcinoma had sensitivity of 96%,specificity of 90%,false positive rate of 10%,false negative rate 4%,positive predictive value of 96%and negative predictive value of 90%,while those of CA125 were 72%,80%,20%,28%,90%and 53.3%,respectively.These two indexes had differences in sensitivity,false negatiye rate and negative predictive value when used to diagnose epithelial ovarian carcinoma(P<0.05),but compared with CA125, LPA had higher sensitivity,lower false negative rate and higher negative predictive value.In early stage patients,LPA used to diagnose epithelial ovarian carcinoma of stageâ… had sensitivity of 90%,specificity of 90%,false positive rate of 10%,false negative rate 10%,positive predictive value of 81.8%and negative predictive value of 94.7%,while those of CA125 were 30%,80%,20%,70%,42.9%and 69.6%,they had difference in sensitivity,false negative rate,positive predictive value and negative predictive value to diagnose primary epithelial ovarian carcinoma of stageâ… (P<0.05),and LPA had higher sensitivity,positive predictive value,negative predictive value and lower false negative rate compare with CA125;but used to diagnose primary epithelial ovarian carcinoma of stageⅡ~Ⅳand relapsed groups,all the indexes of CA125 and LPA had no statistic significance(P>0.05). Youden's index of LPA used to detect primary epithelial ovarian carcinoma of stageâ… ,stageⅡ~Ⅳand relapsed groups were respectively 0.8,0.85 and 0.9,while whose of CA125 were 0.1,0.6 and 0.65.The result indicated that of the two markers used to detect different groups of epithelial ovarian carcinoma,LPA had higher Youden's index than CA125 in full,especially concerning epithelial ovarian carcinoma of stageâ… the Youden's index had risen to 0.8,it pointed out that LPA would be a satisfactory biomarker index to detect epithelial ovarian carcinoma of early stage.3.The positive expression rates of Edg4 and Edg7 proteins were 91.7%and 95.8% (malignant),80%and 70%(borderline),20%and 30%(benign),16.7%and 16.7%(normal),it demonstrated that Edg4 and Edg7 were low-expressed in normal ovarian tissues;in benign epithelial ovarian tumors,Edg4 and Edg7 proteins had a little rise over normal tissues,but there was no statistical significance(P>0.05);but Edg4 and Edg7 proteins expression in borderline and malignant epithelial ovarian tumor was markedly higher than those of normal tissues and benign tumor(P<0.001), most of the epithelial ovarian carcinoma tissues had evident coloration of(+++),which indicate that these two proteins were high-expressed in epithelial ovarian carcinoma tissues.4.The expression of Edg4 and Edg7 proteins in tissues of FIGO stageⅢ~Ⅳwas obviously higher than that of FIGO stageâ… ï½žâ…¡;the expression of two proteins in the G1 tissues was lower than that of G2,G3 tissues significantly;the expression of Edg4 and Edg7 proteins in tissues with lymphoid node metastasis was higher than that of without lymphoid node metastasis;the expression of two receptor proteins in tissues with ascites quantity more than 500ml was higher than that of the ascites quantity less than 500ml.These differences all had statistical significance(P<0.05).According to these results,we concluded that the high-expression of Edg4 and Edg7 proteins in epithelial ovarian carcinoma was significantly associated with FIGO stage, pathological grade,ascites quantity and lymphoid node metastasis.5.The positive expression of Edg7 protein was a little higher than that of Edg4 protein in epithelial ovarian cancer,but there was no significant difference(P>0.05). The tendency of two proteins expression was positive correlation.(r=0.978,P<0.05).Conclusions1.Serum LPA levels in patients with primary and relapsed epithelial ovarian cancer were significantly higher.The sensitivity and negative predictive value of LPA in diagnosis of epithelial ovarian cancer were superior to CA125,and false positive rate was inferior to CA125,they were more obvious in early stage of ovarian cancer, especially.LPA may be a new potential biomarker for diagnosis before operation and monitoring prognosis and recurrence of epithelial ovarian cancer after operation.2.The expression of Edg4 and Edg7 proteins in epithelial ovarian cancer had markedly increased,and was significantly associated with the clinical stage, pathological grade,quantity of ascites and lymphoid node metastasis.The results demonstrated that Edg4 and Edg7 may play an important role in occurrence, development,invasion and metastasis of ovarian cancer.3.The expression degree of Edg4 and Edg7 receptor proteins was positively correlated,which suggests that the two proteins had synergistic effect in the occurrence and development of epithelial ovarian cancer.LPA and its two receptors would become the potential targets to ovarian cancer gene therapy.4.Above results that the high expression of LPA and its receptors in patients with ovarian cancer have proved basis of theory and experiment for our next studies that regulation to LPA signaling transduction pathway by gene engineering inhibits ovarian cancer cells growth.Part 2 The inhibition efficacy on ovarian cancer cells growth by enhancing hLLP3 gene expressionMaterial and Methods1.Extraction and amplification hLPP3 gene from placenta tissue with RT-PCRExtracting total RNA from human placenta and synthesizing the hLPP3 cDNA by RT-PCR.According to the hLPP3 eDNA sequence in GenBank(BC009196),the primers were designed and synthesized as LPP3-1 5' TGGATCCTCCA CCATGCAAAACTACAAGTACGAC 3'(372-392);LPP3-2 5' CCTCGAGCT ACATCATGTTGTGGTGAT 3'(1288-1307).The hLPP3 gene was obtained with the technique of RT-PCR by using human placenta tissues RNA as template.The PCR product was retrieved and identified by agar-gel electrophoresis analysis.2.Construction of recombinant clone and expression plasmids of hLPP3 geneThe PCR product was cloned into pGEM-T easy plasmid(clone vector),thenα-complementation test and T7/SP6 PCR was used to screen the positive clones(pGEM-T-hLPP3),which was digested by restriction enzyme BamHâ… and Xhoâ… ,and finally was subcloned into the pLenExpress vector(expression plasmid). Then the recombinants were identified by PCR and BamHâ… and Xhoâ… cutting,and the target DNA in the recombinant was sequenced finally.So the eukaryotic expression vector pLenEx- press-hLPP3 was constructed successfully.3.Pack and producing lentivirus particles which express hLPP3 geneThe 293FT cells were transfected with the eukaryotic expression vector (pLenEx- press-hLPP3) and another two assisted packing vectors(package kit) assisted by Lipofectamine to pack and produce the lentivirus particles which contain and express hLPP3 gene and green fluorescent protein(GFP),then the titers of lentivirus were detected.4.Cells transfection experiment in vitraTransfecting the ovarian cancer cell lines SKOV3 and OVCAR3 with recombinant lentivirus.After SKOV3 and OVCAR3 were transfected with lentivirus. Experiment was divided into three groups:experimental group(the cells were transfected by lentiveruses which express hLPP3 gene);blank vector control group(the cells were transfected by lentiviruses which express pLenExpress vector gene) and non-transfection control group(the cells were not transfected by lentivirus). The transfection efficiency was detected by fluorescent microscopy,and the positive ceils were selected and maintained by adding G418 to the cell culture medium.The LPA levels of call culture supernatant before and after transfection were detected by biochemical method,the expression level changes of hLPP3 mRNA were measured by real-time quantitative PCR,and the changes of cell apoptosis and cell cycle were detected by flow cytometry.The non-transfected cells and the cells which were transfected with the lentivirus packed with blank pLenExpress vectors were arranged as controls.5.Building ovarian cancer animal models and experiment in vivoThe nude mice were inoculated by subcutaneous injection with SKOV3 and OVCAR3 cell lines and the cell lines which express stably hLPP3 gene,and graft tumor animal models were built.The sizes of tumors were measured,the characteristics of tumor were identified by pathological method,the expression levels of hLPP3 mRNA were detected by real-time quantitative PCR,and the cell apoptosis were determined by flow cytometry.Results1.Target hLPP3 gene was amplified successfullyThe hLPP3 gene was amplified successfully by RT-PCR from human placenta, and the gone band located at about 936bp by agar-gel electrophoresis analysis,which was target gene hLPP3.2.The recombinant clone and eukaryotic expression vectors were constructed successfullyPCR product(hLPP3 gene) was linked to pGEM-T easy vector and amplified by transforming into competent E coli.JM109,and then the target gene was subcloned to expression vector(pLenExpress),the recombinant eukaryotic expression vectors (pLenExpress-hLPP3) were selected and identified through PCR and BamHâ… and Xhoâ… restrictive enzyme cutting test,and then sent to Shanghai for sequencing.The results of sequencing showed that the DNA sequence inserted into the recombinant pLenExpress-hLPP3 was conformed completely to the design.3.High titer of lentivirus and high cell transfecting efficiency were obtainedThe 293 FT cells were co-transfected by pLenExpress-hLPP3 vector wrapped by Lipofectamine and another two assistant package genes,and the lentiviral particles (lentivirus) which express hLPP3 gene were produced.The concentrations of lentivirus are:lentivirus-hLPP3,3.1×107 IU/ml and containing blank vector lentivirus, 2.7×107 IU/ml.The cell transfection efficiency of lentivirus-hLPP3 to SKOV3 was 92%,and that to OVCAR3 was 75%,the former is higher than the latter.And the results also showed that the insertion of hLPP3 gene didn't affect the ability of lentivirus to transfect ovarian cancer cells.4.The mRNA expression level of hLPP3 in experimental ovarian cancer cells increased significantlyAfter transfection by different lentiviruses,the hLPP3 mRNA level of SKOV3 and OVCAR3 cells in experimental group was higher than those in the two control groups(P<0.05),and level of hLPP3 mRNA in two control groups were not different(P>0.05).The different level of hLPP3 mRNA between SKOV3 and OVCAR3 calls had no statistic significance(P>0.05).5.The LPA level in experimental group dropped markedlyThe LPA levels in supernatant of SKOV3 and OVCAR3 which were transfected with lentivirus-hLPP3 were lower significantly compared with the controls(P<0.05), and had the tendency of continual decrease accompanying with time progress,and there was a time-effect relationship.The LPA levels between SKOV3 and OVCAR3 cells had no statistic significance.6.Apoptosis in experimental group was much higherThe apoptosis rate of cancer cells in experimental group increased significantly after transfection(30.50±2.12%vs 0.1±0.03%,P<0.05).The apoptosis rate in experimental group was markedly higher than two control groups(P<0.05).The changes of cell cycle were not significant before and after transfection(P>0.05).7.The ovarian cancer animal models and the transgenic models were constructed successfullySKOV3 and OVCAR3 cells and the two cell lines which express hLPP3 gene were inoculated by subcutaneous injection into nude mice and the graft tumor mass were formed in the injection location.The tumor sizes of experimental group were smaller than those of two control groups(P<0.05),the tumor sizes between SKOV3 and OVCAR3 cell lines were not different(P>0.05).The tissues of graft tumor were examined by HE staining and the features in microscopy were similar to those of human ovarian cancer tissue. 8.Experimental results in vivoThe expression level of hLPP3 mRNA in transgenic tumor tissue were higher than those in two control groups(P<0.05),while the comparison between two control groups had no statistic significance(P>0.05).The expression level of hLPP3 mRNA in SKOV3 and OVCAR3 cells also had no statistic significance(P>0.05).The apoptosis rates of transgenic tumor cells were significantly higher than that in control tumors (16.5%vs 1.26%and 0.10%,P<0.05).The changes of cell cycle in each groups were not significant(P>0.05).Conclusions1.The target gene hLPP3 cDNA was obtained successfully and the recombinant eukaryotic expression vector pLenExpress-hLPP3 and lentivirus expressing hLPP3 gene were constructed and produced successfully.The letivirus carrying green fluorescent protein(GFP) could be identified easily and had high transfection efficiency to SKOV3 and OVCAR3.The cell clones that express hLPP3 gene stably had been built and obtained.2.In vitro,the levels of hLPP3 mRNA in SKOV3 and OVCAR3 cell lines after transfection were significant higher than those before transfection,the concentrations of LPA in cell supematant were significant lower,and the apoptosis rates of cancer cells were significant higher.The results demonstrated that enhancing the expression of hLPP3 gene in ovarian cancer cell lines could decrease LPA level and induce apoptosis of cancer cells effectively,and inhibit the growth of ovarian cancer cells in vitro.The mechanism might be that hLPP3 can inhibit and block the action of LPA by hydrolyzing the extracellular LPA and/or decreasing LPA secretion of cancer cells.3.The ovarian cancer animal models(nude mice) and the transgenic animal models in which the tumor cells express hLPP3 gene stably were built successfully.The growth of tumors expressing hLPP3 gene was slower than that of non-gene transfection models.The levels of hLPP3 mRNA and apoptosis rate of cancer cells in transgenic models were also higher.The above results show that enhancing the expression of hLPP3 gene in ovarian cancer cells also could inhibit the growth of cancer cells,and induce apoptosis of cancer cells effectively in vivo.The mechanism might be the same as that in vitro.4.The effects that enhancing hLPP3 gene expression can inhibit the growth of ovarian cancer cells and promote the apoptosis of cancer cells were testified by our experiments in vitro and in vivo.These results demonstrate that hLPP3 gene might become a new target for ovarian cancer and regulating the expression of hLPP3 gene might be a new way ofgene targeting therapy for ovarian cancer.5.The construction of lentivirus which expresses hLPP3 gene and transfection experiments to ovarian cancer cell lines in vitro and in vivo were not reported domestically or overseas.Part 3 The inhibiting efficacy on growth of ovarian cancer cells by silencing Edg 4 and Edg 7 using RNA interferenceMaterials and methods1.Design and synthesize Edg4 and Edg7 siRNA sequence and hairpin single strand DNA oligonucleotideAccording to the Edg4 sequence in GenBank(NM004720) and Edg7 sequence in GenBank(NM012152),following the rules of siRNA design,we used the siRNA design and analysis software which were provided in following webpage(http://www. ambion.com/techlib/misc/siRNAdesign.html) to design the target oligonucleotides which contain 19 bp.Then the oligonucleotides of target siRNAs were indexed through American National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/Blast) to compare their homology,in order to identify the best siRNA oligonucleotides of Edg4 and Edg7.Afterwards,two pairs of siRNA hairpin single strand DNA oligonucleotides of Edg4,Edg7 and one pair of irrelevant sequence control siRNA oligonucleotide which have palindrome,loop structure and BamHâ… and Xhoâ… restriction enzyme sites were synthesized.2.Construct clone and eukaryotic expression vectors which express target gene The hairpin DNAs were annealed to double strands DNA and were cloned into pGEM-T Easy vector.Then,α-complementation test and T7/SP6 PCR primers were used to screen the positive clones(pGEM-T-siEdg4 and pGEM-T-siEdg7);The target DNAs were cut down from pGEM-T-siEdg4 and pGEM-T-siEdg7 by BamHI and XhoI restriction enzyme,and linked with siRNA expression vector (pRNAT-U6.1/lenti);The positive ones(pRNAT-U6.1/lenti-siEdg4 and pRNAT-U6.1/ lenti-siEdg7) were selected by PCR with general primer.Then the target DNAs were sequenced.3.Pack and produce lentivirus particles which express target siRNA geneThe 293 FT cells were transfected by pRNAT-U6.1/lenti-siEdg4 or pRNAT-U6.1/lenti-siEdg7 or pRNAT-U6.1/lenti-siC or pRNAT-U6.1/lenti vectors and another two assistant package vectors,and the lentiviral particles(lentivirus) containing and expressing target gene and GFP were produced.The titers of lentivirus were measured:4.Transfection experiments in vitroOvarian cancer cell line SKOV3 cells were transfected with the different lentiviruses,and the SKOV3 cells which express different siRNA stably were selected by G418.The experimental groups were divided as follows.The control groups included three subgroups:non-transfection SKOV3 cells,the cells transfected with the lentivirus packed by blank pRNAT-U6.1/lenti vector,and the cells transfected with the lentivirus packed by the irrelevant sequence siRNA vectors.The experimental groups were divided into four subgroups:cells of groupl were transfected with siEdg4/lenti lentivirus,group 2 with siEdg7/lenti lentivirus,group 3 was co-transfected with siEdg4/lenti and siEdg7/lenti lentiviruses,group 4 was co-transfected with siEdg7/lenti lentivirus and the lentivirus expressing hLPP3 gene.The methods used to detect the transfection efficacy of siRNA lentivirus,the levels of Edg4 and Edg7 mRNA,the LPA concentration in supernatant,and the apoptosis of cancer cells before and after transfection were same as those used in part 2.The expression levels of Edg4 and Edg7 proteins were measured by western blotting.5.Build animal models and experiments in vivo Building ovarian cancer animal models with 7 kinds different SKOV3 cells(as same as described in 5) and studying the inhibition efficiency and mechanism of silencing Edg4 and Edg7 on growth of ovarian cancer cells in vivo.The methods were same as those used in part 2.The Edg4 and Edg7 proteins in graft tumor tissues were detected by immunohistochemistry SP method.Results1.The results of Edg4 and Edg7 siRNA target sequences selection and hairpin single strand DNA design and synthesisThe 20 target siRNA oligonucleotides were obtained.After BLAST search in NCBI database,two target siRNA sequences with 19 bases were ensured for each receptor.The target sequences of Edg4-siRNA were:GACCATCGGCTTCTTCTAT (212-230) and GACCAATCTGCTGGTCATA(323-341).And the target sequences of Edg7-siRNA were GCTGGAATTGCCTATGTAT(277-295) and GTCTTGTCTCCGCATA C AA(697-715).The irrelevant control sequence was TACGCTGACTTGATTGTTC.Edg4-1,2 hairpin siRNA oligonucleotide sequences as following:Position in gene sequence:212-230BamHI Target sequence:sense Hairpin Target sequence:antisense XhoI Al 11 5'-GGATCC GACCATCGGCTTCTTCTAT TTCAAGAGA ATAGAAGAAGCCGATGGTC TTTTTT CTCGAGA -3' Al 12 3'-ACCTAGG CTGGTTAGCCGAAGAAGATA AAGTTCTCT TATCTTCTTCGGCTACCAG AAAAAA GAGCRC-5'BamHI Target sequence:sense Hairpin Target sequence:antisense XhoI Al 21 5'-GGATCC GACCAATCTGCTGGTCATA TTCAAGAGA TATGACCAGCAGATTGGTC TTTTTT CTCGAGA -3' Al 22 3'- ACCTAGG CTGGITAGACGACCAGTAT AAGTTCTTCT ATACTGGTCGTCTAACCAG AAAAAA GAGCTC -5' Position in gene sequence:323-341Edg7-1,2 hairpin siRNA oligonueleotide sequences as following:Position in gene sequence:697-715BamHI Target sequence:sense Hairpin Target sequence:antisense XhoI A211 5'-GGATCC GTCTTGTCTCCGCATACAA TTCAAGAGA TTGTATGCGGAGACAAGAC TTTTTT CTCGAGA-3' A212 3'-ACCTAGGCAGAACAGAGGCGTATGTT AAGTTCTCT AACATACGCCTCTGTTCTG AAAAAA GAGCTC-5'BamHI Target sequence:sense Hairpin Target sequence:antisense XhoI A221 5'-GGATCC GCTGGAATTGCCTATGTAT TTCAAGAGA ATACATAGGCAATTCCAGC TTTTTT CTCGAGA-3' A222 3'-ACCTAGGCGACCTTAACGGATACATA AAGTTCTCT TATGTATCCGTTAAGGTCG AAAAAA GAGCTC -5'Position in gene sequence:277-295Irrelevant control sequence siRNA oligonucliotide sequenceBamHIä½ç‚¹Target sequence:sense Hairpin Target sequence:antisense XhoIä½ç‚¹C1 5'- GGATCC TACGCTGACTTGATTGTTC TTCAAGAGA GAACAATCAAGTCAGCGTA TTTTTT CTCGAGA-3' C2 3'-ACCTAGG ATGCGACTGAACTCAAG AAGTTCICT CTTGTTAGTTCAGTCGCAT AAAAAA GAGCTC-5'2.The recombinant clone vector and eukaryotic expression vector which express siRNA were constructed successfullyThe hairpin DNAs of siRNA were annealed to double stranded DNA that the molecular weight band of DNA was identified to locate at about 60bp by agarose gel electrophoresis analysis.They were similar to the ones expected.The annealing products were recombined with pGEM-T Easy vector to form pGEM-T-siEdg4 and pGEM-T-siEdg7,which then were transformed into JM109.After being screened and identified by PCR and,the positive clones(pGEM-T- siEdg4 and pGEM-T-siEdg7) were identified.After sub-cloning,the siRNA expression vectors,pRNAT-U6.1/LentisiEdg4 and pRNAT-U6.1/Lenti-siEdg7 were identified by PCR,BamHI XhoI cutting and sequencing.The results showed that the sequences inserted in recombinant expression vectors were same as those designed.3.Results of different ientivirus titersThe 293FT cells were transfected by siRNA expression vectors with another two package vectors by Lipofectamine,and the siRNA lentiviroural articles were produced. The titers of lentivirus were as below:siEdg4-1/lenti lentivirus:3.2×107IU/ml,siEdg4-2/lenti lentivirus:2.1×107IU/m, siEdg7-1/lenti lentivirus:4.1×107IU/ml,siEdg7-2/lentivirus:3.1×107IU/ml,irrelevant control sequence siC/lenti lentivirus:4.3×107IU/ml,blank vector control pRNAT-U6.1/lenti lentivirus:2.7×107IU/ml.4.Recombinant lentiviruses had high transfection efficiency on ovarian cancer cell line SKOV3A great quantity of GFP can be observed in all transfected SKOV3 cells by fluorescence microscope 48 hours later except the non-transfection cells.The positive cells of all transfected groups were more than 90%(92%~95%).And the positive cell clones were selected by adding G418.The results demonstrated that the siRNA lentiviral particles we produced could transfect SKOV3 cells in high efficiency and the insertion of target siRNA did not affect the ability of lentivirus to transfect ovarian cancer cell line.5.The results of transfection experiments in vitro5.1 The mRNA level of Edg4 and Edg7 in relevant experimental groups transfected by the lentiviruses of siEdg4/lenti and siEdg7/lenti was obviously reduced compared with the controls(P<0.05).The levels of Edg4 and/or Edg7 mRNA in co-transfected groups were lower than single transfection groups(P<0.05).The mRNA level of Edg4 and/or Edg7 were still high in three control groups and there was no difference among them(P>0.05).5.2 There were Edg4 and Edg7 protein bands in control groups showed by western blotting,and the molecular weight was about 40KD.The protein bands of the cells transfected by related siRNA lentivirus was slighter in different experimental groups.5.3 The LPA concentration in supernatant of experimental groups after transfection decreased significantly in time-dependent manner comparing with that of control groups(P<0.05).However,there was no difference in control groups(P>0.05).5.4 The proportion of S stage cells in cell cycle decreased and that of G2 stage cells increased significantly in experimental groups(P<0.05).The apoptosis rate of cancer cells in experimental groups were higher than that in control groups(P<0.05),and the apoptosis in co-transfected groups was much higher.However,the cell cycle had no change and apoptosis was very low in three control groups,and there was no difference among them(P>0.05).6.The results of experiment in vivo6.1 The graft tumors in experim... |