| Radiotherapy is one of the most important methods for the treatment of tumors, but its application is currently limited by the side-effects such as the radiation-induced damages in the normal tissues nearby and the radiation-resistance of certain tumors. To solve these problems we need to find an effective way which could be able to decrease the dose of radiation and at the same time increase the suppression of tumors. It has been repeatedly reported that ionizing radiation can activate early growth response-1 (Egr-1) gene promoter and consequently induce the expression of downstream genes, a recombinant plasmid, pEgr-IL18-B7.1, containing Egr-1, IL-18 and B7.1 was constructed in this study. Besides the direct killing of tumor cells and the suppression of vessels formation in the tumor areas, radiation could also activate Egr-1 promoter and the expressions of IL-18 and B7.1, which might contribute to the increase of anti-tumor effect. The combination of radiation, gene and immunotherapy would provide a promising way for the tumor treatment.Construction of recombinant plasmidThe cloning and identification of murine IL-18Specific primers for mIL-18 were designed with the following primers: sense –ATGGCTGCCATGTCAGAAGACTC,antisense –CTAACTTTGATGTAAGTTAGTG,The splenocytes were retrieved as the template from mice and RT-PCR was used to get the full-length sequence of mIL-18. The product was identified by cleavage of endonucleases and sequencing process, the correct mIL-18 was then used for the following procedures. The construction and identification of recombinant plasmidspCMV-IL18, pCMV-B7.1 and pCMV-IL18-B7.1 were constructed, simultaneously, pEgr-IL18, pEgr-B7.1 and pEgr-IL18-B7.1 were constructed by replacing the CMV promoter with Egr-1 promoter. All the recombinant plasmids were identified and the radiation-induced expression of these plasmids were observed in vivo and in vitro.The transfection of recombinant plasmids and the selection of stable-expression host cells The recombinant plasmids were packed with liposome and transfected into host cells. 48-72h later the cells were removed and re-plated into different flasks(1:4), when the cells were 50-70% confluent, the medium was changed and certain doses of G418 were added for the selection of resistant colonies. After 10-20 days of selection, stable-expression colonies were visible and removed for amplification in large-scale. The enhanced expression properties of recombinant plasmid induced by radiation 3.1 The changes in mRNA levels of IL-18 and B7.1 after different doses of radiationB16 melanoma cells were transfected with recombinant plasmids(pEgr-IL18, pEgr- B7.1 and pEgr-IL18-B7.1 respectively) followed by 0, 0.1 ,0.5, 2.0, and 5.0 Gy of X-radiation 24h later. 12 h after the radiation the total RNA was retrieved from the cells and primers competitive-RT-PCR was used to detect IL-18 and B7.1(the house-keeping gene, GAPDH, was used as internal standard and the ratio of specific band to GAPDH was used as the relative mRNA level). The results showed that in plasmid-transfected group the mRNA levels of IL-18 and B7.1 could be up-regulated by radiation and the increases were in a dose-dependent manner. While IL-18 could not be observed in the control group (without transfection of plasmid).3.2 The changes in protein levels of IL-18 and B7.1 after different doses of radiationB16 melanoma cells were irradiated with 0, 0.1 ,0.5, 2.0, and 5.0 Gy 24 h after the transfection of recombinant plasmid and the supernatants were collected 12 h after the radiation for the detections of IL-18 by ELISA. It was demonstrated that radiation could be able to increase the expression of mIL-18 in plamid-transfected B16 cells. The flow cytometry analysis showed that the expression of surface molecule B7.1 was elevated in a dose-dependent manner. 3.3 The time-course changes in the expression of IL-18 and B7.1 after 2.0 Gy X-radiationB16 melanoma cells were irradiated with 2.0 Gy 24 h after the transfection of recombinant plasmid a...
|
PDF Full Text Request