| AIMFulminant hepatic failure is the main cause of death in viral hepatitis, so it is a great threat for human health. The mechanism of fulminant hepatic failure is very complicated and until now it has not been completely clarified. Recently, many studies showed that the relationship between hepatocyte apoptosis and necrosis was very close , but the mechanism of hepatocyte apoptosis was not clear . Tumor necrosis factor - a and nitric oxide played important roles on hepatocyte apoptosis. Hepatocyte apoptosis was closely correlated with necrosis in experimental study of liver failure induced by tumor necrosis factor - a. Nitric oxide could induce apoptosis in many types of cells, on the other hand , some studies showed that nitric oxide inhibited apoptosis . We studied the role of tumor necrosis factor -a and nitric oxide on hepatocyte apoptosis in fulminant hepatic failure to further explored the role of tumor necrosis factor - a and nitric oxide on liver failure on the apoptic aspect.Many genes play regulation role on hepatocyte apoptosis and apoptosis is completes under the actions of these genes . The regulator genes of apoptosis include Caspase family , Bcl - 2 family , Fas system , and so on . The role of Caspase is especially important and it is called " apoptosis killer" or " apoptosis soldier" , playing crux role on hepatocyte apoptosis . The functions of Fas system and Bcl - 2 family were also important . Previous studies showed that hepatocyte apoptosis was mainly induced by Fas/FasL pathway in liver disease. Bcl - 2 was an important anti - apoptosis factor and Bcl - 2 protein located on mitochondrial membrane could restrict apoptosis through regulating the function of mitochondrion . Activation of Caspase - 3 was important on the role of regulating apoptosis ofBcl - 2 and Fas . We studied the roles of above - mentioned genes on hepatocyte apoptosis in fulminant hepatic failure to explore the mechanism of hepatocyte ap-optosis and provided experimental evidence for clinical treatment .MATERIALS AND METHODSThe experimental animal was Kunming mouse . The groups were divided by 4 different treatments. Lipopolysaccharide and D - galactosamine were injected in 28 of the mice , called model group ,28 of them were given lipopolysaccha-ride , D - galactosamine and anti - TNF - a antibody, called anti - TNF - a group , another 28 were given lipopolysaccharide , D - galactosamine and L -NMMA , an inhibitor of inducible nitric oxide synthase, called anti - NO group , and 20 of them were given same volum of salt solution, called control group . We obtained the samples of serum and liver tissue in 2,4,8,12h after drug administration in every different treatment group (the mice number of each group were 7 in model group, anti -TNF - a group and anti - NO group ,5 in control group) and tested the indexes as following.1. Levels of serum ALT and TBil were tested by biochemical method and HE stainning was carried out in liver tissue to determine the pathological and biochemical changes of liver in fulminant hepatic failure.2. Hepatocyte apoptosis was observed by phenol - chloroform DNA extraction and electrophoresis method in liver tissue . TUNEL method was used to detect apoptic hepatocyte in liver slice, and the positive cells were observed in microscope after DAB stainning.3. Liver RNA was extracted in liver tissue by guanidine isothiocyanate -phenol - chloroform method . After cDNA was synthesized by reverse transcription , PCR reaction was carried out to detect TNF - amRNA and iNOSmRNA expression in liver tissue. The primer sequences of TNF - amRNA and iNOSmRNA were as following respectively : TNF - a - 1 5' - ACCAGAGCG-GCAAGAAGAACCAT - 3'; TNF - a - 2 5' - CATCAGACATCGGAGGCAG-GAAG - 3' (the length of product was 329bp), iNOS -15'- TCGGTG-CAGTCTTTTCCTATGG - 3'; iNOS -25'- TATTAGAGCGGCGGCATGGT - 3' (the length of product was 404bp). Nitrate reductase method was used to test the level of serum nitric oxide and the level of serum TNF - a was tested by ELISA... |
PDF Full Text Request