| Huperzine A (HupA) is one of the most important medicine resources for its outstanding curative effects on Alzheimer's disease (AD). It primary contains in Lycopodium and Huperziaceae, but, their concentrations are only one of thousands or ten thousands and these plants resources mostly grow slowly and demand of especial living conditions and environments. At present, the urgent task is to do some basic application researches using modern biological techniques for producing abundant and low costing medicinal materials of HupA. Investigation Huperziaceae potential resources finds that Huperzia crispata belongs to Huperziaceae Huperzia bernh., which is existing in 300-2600 meters altitude and hiding in darkness woods, and mainly distribute in virgin sub-forest. Distribution in Hunan province is a newly record. Huperzia crispata is the same as the other Huperziaceae, which survival environments are very frailty. If survivor soils were cultivated, it was very difficult to resume propagation. Huperzia crispata is used as traditional herb in west region of Hunan province for thousands years, usually be used to cure injuries and scalds, and others traumas. How to use biochemical techniques improve the concentrations of HupA in especially in Huperzia crispata have not been reported.In order to validation 40 samples that were collected from Japan and China in 8 sites belong to Lycopodiaceae or not, analysis PS-ID sequences and SSR genotype differences, results show that these 40 samples are high homologous and have the sameness PS-ID sequence. In order to comparing HupA concentrations in Huperzia crispata with Huperzia serrata that is used for extract natural HupA these days by HPLC methods, results show that HupA concentrations is higher in Huperzia crispata, which is an excellent novel natural biological resource. In order to obtain natural HupA using biological methods, screening and purify 35 endogenesis fungus from tissue culture materials and fresh Huperzia crispata materials, fermentation products show that four endogenesis fungus have the potential to produce HupA and one Aspergillus niger has the high potential to produce potassium trihydrogen dioxalate dihydrate.Obtaining these five endogenesis fungus can provide reconstructive microbiological materials. It is hopeful to obtain HupA natural products using microbiological fermentation methods. To produce high yield and non-pollution potassium trihydrogen dioxalate dihydrate pure sample using Aspergillus niger fermentation and can reform traditional and chemical synthesis method avoiding of environmental pollution. Part I Analysis SSR gene polymorphism and validation PS-ID type in Huperzia crispataIn order to verification the genesis of Huperzia lucidula (Lycopodiaceae) and our 40 Huperzia crispata samples, we design 13 pairs SSR primers, amplify 8 place point,40 Huperzia crispata samples using PCR methods according to Paul G. Wolf'publishing "The first complete chloroplast genome sequence of a Lycophyte, Huperzia lucidula (Lycopodiaceae) ". The result shows that only the first sample of P2 appears diversity that is amplified using HCtSSR6 prime, the others have not appearing bands diversity. By using PS-ID primers to amplify rpl16-rpl14 interval nucleotide sequences, it has been obtained the PS-ID sequences of Huperzia crispata samples in Chinese and Japanese. The PS-ID sequence is:t aaaattttat ataaatataa atgcaatgtt tttcactatg aaataattaataataattaa atatttaaaa tagatagatt aacctattct aatttttcct tacaaaaccccccaaaaata aagattttta gggggaatat catttctcta atctaaataa ataaat. This sequence is the same as PS-ID in Huperzia lucidula achieved by Paul G. Wolf. Therefore, it has been proved that Huperzia crispata are highly genesis with Huperzia lucidula which were collected in China and Japan. Part II Quantity detection the concentrations of HupA in Huperzia crispata by HPLC methodsIn order to quantitative analysis the concentrations of HupA in Huperzia crispata, we have established high-performance liquid chromatographic (HPLC) detection method for crude extracts in Huperzia crispata. The results show that the precision, accuracy and validate all are in the range of HPLC methods demands. Sample run time is so quickly, only need 10 to 12 minutes for each sample and have high efficiency detection roles which could detect 100 to 120 samples every day. Using this analysis conditions to detect the concentrations of HupA in Huperzia crispata is very validate. Results show that the concentration of HupA in leaf and stalk samples are correlated with theirs maturity degrees, and are mainly concentrated in tender portion on grounds. The concentration of HupA in different sampling point of the same region appears some change trends which is closely correlated with its sunshine concealment degree.Concentrations of HupA in Huperzia crispata are higher than that of Huperzia serrata. The highest concentration in tender growing point of Huperzia crispata is reaching to 600.31μg/g. So, this is another novel resources could provide natural HupA. PartⅢSeparation and identification inner-growth fungus and related metabolize key products in Huperzia crispataIn order to obtain natural HupA resources, we have tried to screen Inner-growth fungus in Huperzia crispata and research theirs fermentation products.It has been screened 35 item inner-growth fungus in the second contamination fungus peak periods during tissue culture and fresh materials of Huperzia crispata. Fermentation results shows that inner-growth fungus No.3, No.6, No.4 and 7 have the potential ability to produce HupA.. No.14 can produce potassium trihydrogen dioxalate dihydrate.According to fungus outlook shape and mycelium microscope observing results, it could be concluded that No.3 is belong to Moniliales Moniliaceae Geotrichum Lk. fungus, No.4 is belong to Eurotiales Eurotiaceae Thielavia Zopf fungus, No.6 is belong to Moniliales Moniliaceae Penicillium Lk.ex Fr. Fungus, No.7 is belong to Mucorales Mucoraceae Mucor Micheli fungus, No.14 is belong to Eurotiales Eurotiaceae Aspergillus niger fungus.In this experiment, it has been found that these 4 fungus the have potential ability to produce HupA, which could provide promising material for micobiological synthesis and anabolism routes about HupA. Aspergillus niger can produce potassium trihydrogen dioxalate dihydrate, which is could be widely used in tan, fabric neaten, intermediary dye, metal polishing, guard against rust, organize raw material, catalyst, chemical benchmark and analysis reagent, could be used in sensitization material preparation and industry extensive purpose. |